ID: 1005979779

View in Genome Browser
Species Human (GRCh38)
Location 6:30828121-30828143
Sequence CTGGGTCAACAGATGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005979772_1005979779 0 Left 1005979772 6:30828098-30828120 CCAGTGTTCCACATCATTCTGAC No data
Right 1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG No data
1005979770_1005979779 17 Left 1005979770 6:30828081-30828103 CCCAGTGAGTTAACTGTCCAGTG No data
Right 1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG No data
1005979775_1005979779 -8 Left 1005979775 6:30828106-30828128 CCACATCATTCTGACCTGGGTCA No data
Right 1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG No data
1005979771_1005979779 16 Left 1005979771 6:30828082-30828104 CCAGTGAGTTAACTGTCCAGTGT No data
Right 1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005979779 Original CRISPR CTGGGTCAACAGATGGAGGC AGG Intergenic
No off target data available for this crispr