ID: 1005984995

View in Genome Browser
Species Human (GRCh38)
Location 6:30866178-30866200
Sequence GTTCCAGTTCATCACAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005984992_1005984995 -1 Left 1005984992 6:30866156-30866178 CCTTGGAGATATTGCGGGCCCAG No data
Right 1005984995 6:30866178-30866200 GTTCCAGTTCATCACAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005984995 Original CRISPR GTTCCAGTTCATCACAATAA AGG Intergenic