ID: 1005989935

View in Genome Browser
Species Human (GRCh38)
Location 6:30896519-30896541
Sequence CCGGAGGGCCCTGTGTCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005989935_1005989941 -8 Left 1005989935 6:30896519-30896541 CCGGGAGACACAGGGCCCTCCGG 0: 1
1: 0
2: 3
3: 28
4: 243
Right 1005989941 6:30896534-30896556 CCCTCCGGGAGGCTGAGGTGTGG 0: 1
1: 2
2: 39
3: 647
4: 2543
1005989935_1005989944 -6 Left 1005989935 6:30896519-30896541 CCGGGAGACACAGGGCCCTCCGG 0: 1
1: 0
2: 3
3: 28
4: 243
Right 1005989944 6:30896536-30896558 CTCCGGGAGGCTGAGGTGTGGGG 0: 1
1: 21
2: 1618
3: 31086
4: 96293
1005989935_1005989946 9 Left 1005989935 6:30896519-30896541 CCGGGAGACACAGGGCCCTCCGG 0: 1
1: 0
2: 3
3: 28
4: 243
Right 1005989946 6:30896551-30896573 GTGTGGGGAACTATAGCTCTTGG 0: 1
1: 0
2: 0
3: 5
4: 79
1005989935_1005989947 10 Left 1005989935 6:30896519-30896541 CCGGGAGACACAGGGCCCTCCGG 0: 1
1: 0
2: 3
3: 28
4: 243
Right 1005989947 6:30896552-30896574 TGTGGGGAACTATAGCTCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 96
1005989935_1005989943 -7 Left 1005989935 6:30896519-30896541 CCGGGAGACACAGGGCCCTCCGG 0: 1
1: 0
2: 3
3: 28
4: 243
Right 1005989943 6:30896535-30896557 CCTCCGGGAGGCTGAGGTGTGGG 0: 1
1: 0
2: 5
3: 92
4: 1127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005989935 Original CRISPR CCGGAGGGCCCTGTGTCTCC CGG (reversed) Intronic
900114984 1:1024562-1024584 TCGGAGGGGCCTTTGTCTCCAGG - Intronic
900158248 1:1212026-1212048 CCGGGGGGCCCTGGGTCTCCTGG + Exonic
900161694 1:1227116-1227138 CGGGAGGGCCCTGAGGATCCAGG - Intronic
900162163 1:1228891-1228913 ACGGAGGGCTCTGTGTCCCCAGG + Exonic
900163472 1:1235507-1235529 CCTGCCGGCCCTGTGCCTCCTGG - Intergenic
902619926 1:17644835-17644857 CCGGAGTGCCTGGTGTCTGCTGG + Intronic
904001884 1:27343357-27343379 CAGAGGGGCCCTGTGGCTCCAGG + Intronic
904885954 1:33738623-33738645 CTGGTTGGCCCTGAGTCTCCTGG + Intronic
905506748 1:38485848-38485870 CCACTGGGCCCTATGTCTCCAGG - Intergenic
905909050 1:41641361-41641383 CCGGAGGACCCTGGGTCACCAGG - Intronic
906278514 1:44536501-44536523 GCTGTGGGCCCTGTGTCCCCAGG + Intronic
920210308 1:204323150-204323172 CCGGAGGGCACTGAGTGTCAGGG - Intronic
922025172 1:221742839-221742861 CCGGAGGGCCCTGCTCCGCCCGG + Intergenic
922062895 1:222108567-222108589 CCTTAGGGCTCTGTGTCTCTGGG - Intergenic
922218536 1:223540208-223540230 CAGGAGAGCTCAGTGTCTCCTGG - Intronic
922579675 1:226687675-226687697 CAGGAGGGCACTGTGTCTCTAGG - Intronic
1064003486 10:11682465-11682487 CCGGAGAGCTCTGTCTCTTCTGG + Intergenic
1065793181 10:29280491-29280513 CAGGAGGGCCCCGTCTCTGCTGG - Intergenic
1065879359 10:30026231-30026253 CCGGGAGGCCTTGTGTCTCCTGG - Exonic
1066211357 10:33242149-33242171 CTGGACAGCCCTGTGTCTTCTGG - Intronic
1066751243 10:38659430-38659452 CGGGAGTGCCCTGTTTTTCCAGG - Intergenic
1066965802 10:42263661-42263683 CGGGAGTGCCCTGTTTTTCCAGG + Intergenic
1067071954 10:43138692-43138714 GCGGGGGGCCCTGTCTCTCAGGG + Intronic
1070759917 10:79017675-79017697 CTGGGGGGCCCTGCATCTCCTGG - Intergenic
1070887885 10:79920999-79921021 CCAGAAGTCCCTGTGTTTCCTGG - Intergenic
1075022739 10:118963552-118963574 CCGGGGTGCCCAGTGTCTGCGGG - Intergenic
1076745273 10:132509803-132509825 CAGGAGGGCCCTGTGTGGGCGGG - Intergenic
1077021958 11:420898-420920 GCGGAGGGGCCTGGGGCTCCCGG + Intronic
1078196166 11:9138663-9138685 CCTGAGGGCCTGGGGTCTCCTGG - Intergenic
1078429132 11:11274129-11274151 CCGGAGTGCACTGTTCCTCCCGG - Intronic
1079112540 11:17612878-17612900 CCTGAGCTCCCTCTGTCTCCAGG + Intronic
1079131048 11:17747219-17747241 CCTGAGCTCCCTGTGTGTCCTGG + Intronic
1079301703 11:19284371-19284393 CCAGAGCCTCCTGTGTCTCCTGG + Intergenic
1082023311 11:47552874-47552896 CCGGAGGGCCCTGTGACCCGCGG + Intronic
1083307479 11:61768885-61768907 CCCTAGGGCCCTGTGTTTCCAGG + Intronic
1083714953 11:64569805-64569827 GCGGAAGTCCCTGGGTCTCCGGG - Exonic
1084692305 11:70734522-70734544 CAGGAGGGCTCTGTGTCCGCTGG - Intronic
1085291057 11:75399747-75399769 CAGGAGGGCGCTGTGTGGCCGGG + Intronic
1085702438 11:78756902-78756924 ACACAGGGACCTGTGTCTCCTGG + Exonic
1087850835 11:103027564-103027586 CTGGAGGGCCCTGTCTCTGTGGG + Intergenic
1089642308 11:119855871-119855893 CATGAGTGCCCTGTGTCTCAGGG + Intergenic
1091239407 11:134042566-134042588 CCGGGAGGCCCTGTGGTTCCTGG + Intergenic
1091305005 11:134531228-134531250 TCGGAGGCCCCAGAGTCTCCAGG + Intergenic
1095097631 12:38156796-38156818 CGGGAAGGCACTGTGCCTCCTGG - Intergenic
1096683061 12:53269677-53269699 CCAGAGGGCCCTCTGCCTCTTGG + Exonic
1096992510 12:55816880-55816902 CGGGTGGGCCCTGCATCTCCTGG - Intronic
1097177056 12:57149373-57149395 CGGGCCAGCCCTGTGTCTCCCGG + Intronic
1102967919 12:117142243-117142265 CAGGTGGTCCCTGAGTCTCCAGG - Intronic
1104558822 12:129825542-129825564 GTGGAGGGCCTTGTGTCCCCAGG - Intronic
1104925220 12:132310461-132310483 CCGGAGGGCTCTCAGCCTCCAGG - Intronic
1105454300 13:20525966-20525988 TCGGCGCGCCGTGTGTCTCCCGG - Intergenic
1105574809 13:21640458-21640480 CAGGAGAGCCCTGTATCTTCAGG + Intergenic
1105930337 13:25046824-25046846 CAGACGGGCCCTGAGTCTCCAGG - Intergenic
1106670893 13:31903910-31903932 CTGGGGGTCCCTGTGTCCCCAGG + Intergenic
1106938317 13:34748242-34748264 CCTGAGAGCCCTGTATTTCCTGG - Intergenic
1108403915 13:50081321-50081343 CCGGAGGGACCCATGACTCCGGG + Intergenic
1112009189 13:95279829-95279851 CTGGGGGGCCCTGTGGCTCCAGG - Intronic
1112356450 13:98677974-98677996 CAAGAGGGTCCTGTGTGTCCGGG - Intergenic
1112565558 13:100548846-100548868 CCTGTGGACCCTGTGTCCCCTGG - Intronic
1113459696 13:110473120-110473142 CCAGGGGGGCCTCTGTCTCCGGG - Exonic
1113743040 13:112724342-112724364 AGGGAGGGCCCTGTGACTCAGGG + Intronic
1113791244 13:113029595-113029617 CCTGAGGGTGCTGTGTCCCCGGG + Intronic
1113816244 13:113173076-113173098 GCTGAGGGCTCTCTGTCTCCAGG - Intergenic
1113906726 13:113822721-113822743 CGGGAGGGCTCTGTGGCCCCGGG + Intronic
1113989820 13:114352681-114352703 ACGGAGGGCCCTCTTGCTCCCGG - Intergenic
1119049721 14:71354937-71354959 CCCCCGGGCCCTGGGTCTCCAGG - Intronic
1119916575 14:78407557-78407579 CCTGAGGGCCCTCTGAATCCTGG - Intronic
1121326782 14:93024813-93024835 CCCCAGGTCCCTGTGGCTCCGGG + Intronic
1122638519 14:103142517-103142539 TAGGAGGGCTCTGTGTGTCCTGG - Intergenic
1122902404 14:104787297-104787319 GCAGAGGGCCCTGGGGCTCCAGG - Intronic
1122934746 14:104950745-104950767 CCAGAGGGCCCTGTGTCCGAGGG - Exonic
1122935215 14:104952725-104952747 CCGGAGGGCCCTGTGCCCGAGGG - Exonic
1123019620 14:105391561-105391583 CCGGAGGGCCTGGTGGCACCCGG + Intronic
1123707417 15:22960083-22960105 CCTGTGGGCCGAGTGTCTCCCGG + Intronic
1125610557 15:40966505-40966527 CCCCAGAGCCCTGTGTCCCCAGG + Intergenic
1128425974 15:67542798-67542820 GCGCCGCGCCCTGTGTCTCCGGG + Exonic
1128498177 15:68210094-68210116 CGGGAGGTGCCTCTGTCTCCAGG - Intronic
1130013508 15:80170399-80170421 CTGGAGCTCCCTGTCTCTCCTGG + Intronic
1132542742 16:518866-518888 CCAGTGTGCCCTGTGTCTCAGGG - Intronic
1132937317 16:2487760-2487782 CCGGGGTGGCCTGTGTCTCCAGG + Intronic
1133064272 16:3195048-3195070 GCGGAAGGCCCCGTGTCCCCCGG + Intergenic
1133115817 16:3577384-3577406 CCGGCTGTCCCTGTGGCTCCGGG + Intronic
1133183936 16:4081704-4081726 GAGGAGGGCGCTGTGTCTGCAGG + Intronic
1133729891 16:8569928-8569950 CCGGGAGGCGCTGTGTCTCTTGG - Exonic
1135536894 16:23301877-23301899 CCAGAGGACACTGTGTCTGCAGG + Intronic
1136731481 16:32417675-32417697 CGGGAGTGCCCTGTTTTTCCAGG + Intergenic
1136922918 16:34346379-34346401 CAGGAGGCCCCAGTGGCTCCAGG + Intergenic
1136981655 16:35065427-35065449 CAGGAGGCCCCAGTGGCTCCAGG - Intergenic
1137724289 16:50646598-50646620 AGGGAGGGCACTGTGTCCCCAGG - Intergenic
1138009418 16:53363502-53363524 CCCTTGGGCCCTCTGTCTCCAGG + Intergenic
1138114266 16:54347950-54347972 CCTGAGGGCTCTGTGTCTTCTGG + Intergenic
1138247693 16:55479518-55479540 CCTGAGGGCGCTCTGTCTCCTGG + Exonic
1138686784 16:58733549-58733571 CCCGAGGTCCCTGTGACCCCGGG - Intronic
1139517830 16:67462193-67462215 CCTGCAAGCCCTGTGTCTCCTGG - Intronic
1141162552 16:81638963-81638985 CCGGCGGGGGCTGTTTCTCCAGG - Intronic
1141442873 16:84040774-84040796 CGGGAGGGTCATGTGTCTCTGGG - Intronic
1141678935 16:85532705-85532727 CAGGATGGGCCTGTGGCTCCAGG + Intergenic
1202994911 16_KI270728v1_random:99595-99617 CGGGAGTGCCCTGTTTTTCCAGG - Intergenic
1203021598 16_KI270728v1_random:411937-411959 CGGGAGTGCCCTGTTTTTCCAGG - Intergenic
1142741825 17:1936107-1936129 CTGGAGGGCCCCGTGGTTCCTGG - Exonic
1144103017 17:11960837-11960859 CCGTAGGGCCTGGAGTCTCCTGG - Intronic
1144773874 17:17774437-17774459 CCGGAGGCCCCTGCGGCCCCAGG - Intronic
1145078523 17:19875277-19875299 CCTGGTGGCCCTCTGTCTCCTGG - Intergenic
1145369611 17:22297971-22297993 CCGGAGGACCCTCTCTCACCGGG + Intergenic
1147689615 17:42307326-42307348 CAGGAGGGCCCTGACTTTCCTGG + Intronic
1148520408 17:48269464-48269486 CCTGAGGGACCTGTATTTCCAGG + Intronic
1149317147 17:55449219-55449241 CTGGAGGGACCTGTCTATCCAGG + Intergenic
1150294707 17:64001592-64001614 CAGGAGGGCCCTGTGCCCTCTGG + Intronic
1150651099 17:67010732-67010754 CTGGAGGGCTCTATGTTTCCAGG - Intronic
1151583487 17:74993806-74993828 AAGGAGGGCCCTGTGTCATCTGG - Intronic
1152345612 17:79748696-79748718 CCGAAGGCCCCAGTCTCTCCTGG + Intergenic
1152351302 17:79785311-79785333 CCGGTGGCACCTGTGGCTCCAGG + Exonic
1152581757 17:81168436-81168458 TCAGAGGGCCCTGTGCTTCCTGG - Intergenic
1152627136 17:81393069-81393091 CCGTGGGGCCCAGTCTCTCCTGG - Intergenic
1152853217 17:82649268-82649290 CCTGGGGGCACTGTGTGTCCTGG - Intergenic
1153643065 18:7172279-7172301 CCTGGTAGCCCTGTGTCTCCAGG - Intergenic
1154202385 18:12308391-12308413 CTGGCGGGCCCCGGGTCTCCCGG + Intronic
1154356238 18:13624786-13624808 AGGGAGGGCCCTGTGCCCCCTGG + Intronic
1155509544 18:26562805-26562827 CCAGAGAGCCCTCTCTCTCCAGG - Intronic
1156462004 18:37326429-37326451 CCGGAGGGCCCTGTGGCTTGTGG + Intronic
1158315780 18:56210136-56210158 ACAGAGGGCCCTGAGGCTCCTGG + Intergenic
1159108797 18:64032460-64032482 CCCGAGGGCCCTGTGTCCTGGGG + Intergenic
1159581261 18:70236663-70236685 CCGGAATGCACTGTCTCTCCCGG - Intergenic
1160134546 18:76261363-76261385 CCACTGGGGCCTGTGTCTCCGGG + Intergenic
1160169957 18:76544761-76544783 CTGGAGGGCCCTGTGGGTCTGGG + Intergenic
1160875262 19:1293858-1293880 CCGGGGGTTCCTGGGTCTCCAGG - Intronic
1160908823 19:1465524-1465546 CCGGCGGGCCCTGCTTCTCCAGG - Exonic
1161321463 19:3643591-3643613 CCAGAGGGCCCTGTGCAGCCTGG + Intronic
1163630851 19:18417369-18417391 CCCCAGGGCCCTGTGTGCCCTGG - Intergenic
1163755999 19:19106417-19106439 CCCGGGGGCTCTGTGTCTCGGGG + Intronic
1164591648 19:29510914-29510936 CGGGAGGGCAATGTGGCTCCAGG + Intergenic
1165745734 19:38228862-38228884 CGGGAGCGCCCTCGGTCTCCGGG - Intronic
1165833327 19:38740288-38740310 CTGCAGGGGCCTGTGTCTCAGGG + Intronic
1165939738 19:39409065-39409087 CCTGAGGTTCCAGTGTCTCCTGG + Exonic
1166253708 19:41587674-41587696 CTGGAGGGGCCTGTGGGTCCAGG - Intronic
1167426436 19:49432148-49432170 CCCTAGGACCCTGTCTCTCCAGG + Intronic
1168176711 19:54632259-54632281 CTGGAGTTCCCTGAGTCTCCAGG + Intronic
926063969 2:9822504-9822526 CCACAGGGCCATGTGTCTCGGGG - Intergenic
926761029 2:16279266-16279288 CAGGAGGACTCTGTGTCTTCGGG + Intergenic
927809491 2:26173480-26173502 CGGGTGGGCCCCGCGTCTCCCGG - Intronic
928443321 2:31311697-31311719 CCTGTGGGCTCTGAGTCTCCTGG - Intergenic
929007048 2:37405866-37405888 CCAGAGGTCACTGTGTCTCTGGG + Intergenic
929576449 2:43055685-43055707 CTCTAGGGCCCTGTGGCTCCAGG - Intergenic
932346904 2:71001580-71001602 AGGGAGGGCCCTGGGCCTCCAGG - Intergenic
937243349 2:120476495-120476517 CCTGTGGGCCATGTGTCTACAGG + Intergenic
944440410 2:199737647-199737669 CCTGGGGCCACTGTGTCTCCTGG + Intergenic
946413214 2:219526032-219526054 GGGGAGGGCCCTGGGCCTCCAGG - Intronic
947670992 2:231935191-231935213 CAGGGCAGCCCTGTGTCTCCTGG + Intergenic
948639979 2:239369372-239369394 CTGGGGAGCCCTGTGGCTCCCGG - Intronic
1170567636 20:17615867-17615889 CCCCTGGGCCCTGAGTCTCCAGG - Intronic
1170786794 20:19474254-19474276 CAAGAAGGCCCTGTGTCCCCCGG + Intronic
1170939408 20:20836042-20836064 CAGGAGAGCCGTGTGGCTCCAGG - Intergenic
1172719028 20:36985169-36985191 CCGGGAGGCCTTTTGTCTCCTGG - Intergenic
1174348996 20:49953541-49953563 CCAGTGGGCCCTGTGTTTGCTGG - Exonic
1174380401 20:50152485-50152507 CAGGAGGGCCCTATATCCCCAGG - Intronic
1174796221 20:53524843-53524865 CCGGAGGCCACTGGGTCTCTTGG - Intergenic
1175761028 20:61562247-61562269 ACGGAGGTCCCTCTCTCTCCGGG - Intronic
1175945763 20:62558016-62558038 CCGGAGGCCCCTGGGTGCCCAGG + Intronic
1176044315 20:63084410-63084432 GCTCAGGGGCCTGTGTCTCCCGG + Intergenic
1176109889 20:63406412-63406434 GGGCAGGGCCCTGTGGCTCCAGG - Exonic
1176373184 21:6074649-6074671 CAGGAGGGGGCTGTGTCTGCAGG + Intergenic
1176376932 21:6091480-6091502 GTGGGGGGCGCTGTGTCTCCAGG + Intergenic
1176898878 21:14416592-14416614 CCACAGTGCCCTGTCTCTCCAGG + Intergenic
1178341721 21:31791197-31791219 CAGGAGTGTTCTGTGTCTCCAGG - Intergenic
1179746543 21:43446764-43446786 GTGGGGGGCGCTGTGTCTCCAGG - Intergenic
1179750293 21:43463594-43463616 CAGGAGGGGGCTGTGTCTGCAGG - Intergenic
1180098968 21:45575465-45575487 CCGGCTGGCCCTGTGTGTCCTGG + Intergenic
1180147094 21:45927799-45927821 CAGGAAGGCCTGGTGTCTCCAGG - Intronic
1180159347 21:45992170-45992192 CCGGGGGGCCCAGGCTCTCCCGG - Exonic
1180540991 22:16447465-16447487 CGGGAGTGCCCTGTTTTTCCAGG - Intergenic
1180914001 22:19472612-19472634 CCCGGGGGCCCAGTGTCTCCTGG - Intronic
1180925924 22:19555045-19555067 CAGGAGGGCTCTGTGACTCCAGG - Intergenic
1182735296 22:32528887-32528909 GGGGAGGGCGCTGTGCCTCCTGG + Exonic
1183026359 22:35068399-35068421 CAGGAGGGCTGTGTGTCTGCAGG + Intronic
1183464418 22:37972577-37972599 GTGCTGGGCCCTGTGTCTCCTGG + Exonic
1183524462 22:38315334-38315356 CCGGGGTTCCCTGTCTCTCCTGG - Intronic
1183627287 22:39012210-39012232 CCGCAGTGCACTGTGTCTCTGGG + Intergenic
1184030973 22:41894563-41894585 GGGGAGGGTGCTGTGTCTCCTGG - Intronic
1184572898 22:45337812-45337834 CCTGAGGGCCATGTGTCTGCAGG + Intronic
1184688764 22:46108147-46108169 CCTGAGGGCCCTGTGTTCCCTGG - Intronic
1184872686 22:47251062-47251084 CCGGAGGCCCCTGTAGCTCCAGG + Intergenic
949440984 3:4080060-4080082 CCAGAGGGTCCTGTATTTCCAGG + Intronic
949632588 3:5944445-5944467 CAGGAGTGCCCTGTTTTTCCAGG + Intergenic
952945068 3:38473541-38473563 GGGGAGGCCCCTGGGTCTCCAGG + Intronic
954121234 3:48501341-48501363 AGGGAGGGCGCTGTGTCTGCTGG - Intronic
954135193 3:48579204-48579226 CCAGAGGGCCCAGCGGCTCCTGG + Exonic
954575985 3:51676466-51676488 GGGGTGGGCCCTGGGTCTCCAGG + Intronic
957728129 3:84095008-84095030 CTGGATGTCCCTGTGTTTCCGGG - Intergenic
960787708 3:121392274-121392296 CAGGAGTGCCCTGTTTTTCCAGG + Intronic
961458655 3:127036718-127036740 CCCATGGGCCCTGTGTCTGCAGG + Exonic
962845147 3:139267410-139267432 CCTGTTGGCCCTGTGTCTGCTGG - Intronic
970071294 4:12162571-12162593 CTAGAGTGCTCTGTGTCTCCAGG - Intergenic
970599771 4:17632567-17632589 GCGGAGAGCCCTGTTTCTGCTGG + Exonic
975113613 4:70653955-70653977 CAGAAGAGTCCTGTGTCTCCCGG + Intronic
976089192 4:81438182-81438204 CTGTAGGTACCTGTGTCTCCAGG - Intronic
976338532 4:83919049-83919071 CCTGATGGCCCTGAGTCTCCTGG + Intergenic
977946454 4:102919677-102919699 CAGGAGTGCCCTGTTTTTCCAGG - Intronic
981747313 4:148064030-148064052 CCGGCTGGCCGTGTGTCTCCAGG + Intronic
985212670 4:187612027-187612049 CCTCAGGTCCCTGTGTGTCCAGG + Intergenic
985484013 5:139031-139053 CCGGTGCTCCCTGTGGCTCCCGG - Intergenic
987101402 5:14594512-14594534 CAGGAGGACACTGTGTCCCCAGG + Intronic
987241366 5:16003632-16003654 CCTGAGGGCCCTCTGTATCAGGG + Intergenic
989099953 5:37814068-37814090 TGGAAGGCCCCTGTGTCTCCCGG + Intronic
999525911 5:152405314-152405336 GGGGAGGGGCTTGTGTCTCCGGG - Intronic
1000351278 5:160354848-160354870 CCTGAGGGCCCTGGGGCTCCTGG + Exonic
1001590785 5:172863480-172863502 CCCAAGGGTCCTTTGTCTCCTGG - Intronic
1002044644 5:176535068-176535090 CTGGAGGCCCTTCTGTCTCCTGG - Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002542226 5:179913825-179913847 CTGGCTGGCCCTGTGTCTCACGG - Intronic
1002563489 5:180097746-180097768 CCTGAGCCCCCTGTGTCCCCTGG - Intergenic
1004035748 6:11921114-11921136 CCCAAGGGCCCTGGGTGTCCTGG + Intergenic
1005886914 6:30103928-30103950 TCGGAGCGCCCTCTGTTTCCTGG + Intronic
1005989935 6:30896519-30896541 CCGGAGGGCCCTGTGTCTCCCGG - Intronic
1006376688 6:33675486-33675508 CCGGAGTGACCCGTGTCTCCTGG - Intronic
1006874539 6:37283972-37283994 TCGGAGGGCTGTGTGTGTCCAGG - Intronic
1007392073 6:41555324-41555346 CCATAAGGCCTTGTGTCTCCGGG + Intronic
1008148958 6:47927021-47927043 CTGGAGAGCCCTTTGCCTCCAGG + Intronic
1015488582 6:133799963-133799985 TAGGAGGGTCCTGGGTCTCCAGG - Intergenic
1016603288 6:145888577-145888599 CTGGAAGGCCCTGTGTGACCTGG - Intronic
1017956947 6:159186610-159186632 CCAGAGACCCCTGTGTCTCTGGG - Intronic
1018956311 6:168412719-168412741 CCGGAGGTGGCTGTGTCTCCAGG + Intergenic
1019436888 7:1026997-1027019 ACGGCGGGTGCTGTGTCTCCGGG - Intronic
1019675860 7:2312208-2312230 CCTGAGGGAGCTGTGTCTCTGGG - Intronic
1019711748 7:2521130-2521152 TCAGAAGGCCCTGGGTCTCCGGG - Intronic
1022351058 7:29566305-29566327 CCGGAGGGCCTAGGGGCTCCCGG - Exonic
1023797779 7:43808145-43808167 CAGGAGGGCCTTGTGTCTCCAGG + Intergenic
1024943714 7:54788003-54788025 CTGGAGGCCCCTGTCTGTCCAGG + Intergenic
1025807639 7:64850095-64850117 CCGGTGGGCTCTGAGTCTTCTGG - Intergenic
1027266306 7:76496944-76496966 CAGGAGGGCCCAGGGCCTCCTGG + Intronic
1027317686 7:76995062-76995084 CAGGAGGGCCCAGGGCCTCCTGG + Intergenic
1028599873 7:92590130-92590152 GCGGAGGGTGCTGGGTCTCCAGG + Intronic
1030084980 7:105808143-105808165 CCTGCAGGCCCTGTGTGTCCTGG - Intronic
1031985392 7:128161249-128161271 TGGCAGGGCCCTTTGTCTCCAGG + Intergenic
1032500812 7:132398443-132398465 CAGGAGGGCCCTGGGTGTGCGGG + Intronic
1033546714 7:142407709-142407731 CTGGATGGCCCTCTGTCTCCTGG + Intergenic
1033549521 7:142433976-142433998 CTGGGCGGCCCTCTGTCTCCTGG + Intergenic
1033560892 7:142529310-142529332 CTGGATGGCCCTGTGTCTCCTGG + Intergenic
1035022992 7:155809795-155809817 CCGCTGGGCCCTGCGTCCCCCGG + Intronic
1035249302 7:157586655-157586677 GCAGGGGGCCCTGAGTCTCCAGG - Intronic
1035306504 7:157936467-157936489 ACGGAGGCACCTCTGTCTCCTGG + Intronic
1035344740 7:158190706-158190728 CAGGAGGGCCCAGTGGCACCTGG - Intronic
1035742615 8:1939580-1939602 GCCGAGGGCCCTGTGCCTGCAGG - Intronic
1038753252 8:30316427-30316449 CCAGAAGGCCCTGGGTCTCCAGG - Intergenic
1039415030 8:37386264-37386286 GAGGAGGGCCCTGTGGCACCTGG + Intergenic
1039954254 8:42195145-42195167 CTGGAAGCCCCTGTGCCTCCAGG - Intronic
1047171534 8:122497980-122498002 CCATAGGGCACTCTGTCTCCAGG - Intergenic
1048876061 8:138837734-138837756 CTGGAGGGCCCTGCGGTTCCAGG + Intronic
1049394869 8:142395314-142395336 CCTGAGGGCCTGGTGCCTCCCGG - Intronic
1049658370 8:143808796-143808818 GGGGAGGGCCCTGTGGCTCCCGG - Exonic
1050244733 9:3676819-3676841 CCAGGGAGTCCTGTGTCTCCAGG - Intergenic
1051680176 9:19599638-19599660 GAGGAGGGCCTTGTGGCTCCTGG - Intronic
1056121233 9:83491401-83491423 CCAGTGTGCTCTGTGTCTCCAGG - Intronic
1056709218 9:88977124-88977146 CCTAAGTGCCCTGTGTATCCTGG - Intergenic
1060152923 9:121300014-121300036 CCGGGGGGCCCCGGGGCTCCCGG + Intronic
1060939990 9:127537681-127537703 CAGGTGGGCCCTGTGTCTGATGG - Intronic
1061014361 9:127973359-127973381 CCTGAGGGCCCTGCTTGTCCAGG - Intronic
1061318151 9:129810389-129810411 CGGGAGGGGCCTGTCTGTCCAGG - Exonic
1061538757 9:131266062-131266084 ACGGGGAGGCCTGTGTCTCCGGG + Intronic
1061651275 9:132052144-132052166 CCAGCAGGCCCTGGGTCTCCTGG + Intronic
1062008286 9:134252718-134252740 CCGGAGTGTCCGGTGACTCCTGG + Intergenic
1062032551 9:134368218-134368240 CCACAGTGCCCTGTGTCCCCAGG + Intronic
1062049028 9:134437786-134437808 CCCGAGGGCGCTGCGACTCCGGG - Intronic
1062049394 9:134439282-134439304 CCGGGGTGCCCTGGGTCCCCAGG - Intronic
1062138663 9:134943621-134943643 ACGGAGGGCGCTGTGCCTCTTGG + Intergenic
1062333186 9:136053469-136053491 CAGCTGGGCCCTGTGTCTCCTGG - Intronic
1062573395 9:137195640-137195662 GCGGACGGCCCTGGGTGTCCAGG + Intronic
1186440142 X:9578958-9578980 CCAAAGGCCCCTGGGTCTCCAGG - Intronic
1186534255 X:10330346-10330368 GGGGAGGGCCCTCTGGCTCCTGG - Intergenic
1188004296 X:25006656-25006678 CCAGAGGGCCTGGTGGCTCCAGG + Intronic
1197998997 X:132412322-132412344 CAGGAGGGCCCTGCATTTCCAGG + Intronic
1199239059 X:145525781-145525803 CTGCAGTGCTCTGTGTCTCCAGG + Intergenic
1200986382 Y:9306330-9306352 CCGGCAGGGCCTGAGTCTCCAGG + Intergenic
1202107397 Y:21385340-21385362 CCGGCAGGGCCTGAGTCTCCAGG + Intronic
1202124195 Y:21554572-21554594 CCGGCAGGGCCTGAGTCTCCAGG - Intergenic
1202154813 Y:21874808-21874830 CCGGCAGGGCCTGAGTCTCCAGG + Intergenic