ID: 1005990284

View in Genome Browser
Species Human (GRCh38)
Location 6:30897998-30898020
Sequence GTGGGCTCTCTCTCCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 361}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005990272_1005990284 11 Left 1005990272 6:30897964-30897986 CCACATGGGGAGCCAGAGTGACC 0: 1
1: 0
2: 2
3: 17
4: 181
Right 1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG 0: 1
1: 0
2: 4
3: 50
4: 361
1005990270_1005990284 17 Left 1005990270 6:30897958-30897980 CCACCTCCACATGGGGAGCCAGA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG 0: 1
1: 0
2: 4
3: 50
4: 361
1005990271_1005990284 14 Left 1005990271 6:30897961-30897983 CCTCCACATGGGGAGCCAGAGTG 0: 1
1: 2
2: 2
3: 22
4: 258
Right 1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG 0: 1
1: 0
2: 4
3: 50
4: 361
1005990278_1005990284 -1 Left 1005990278 6:30897976-30897998 CCAGAGTGACCGGGCCCGGGGAG 0: 1
1: 0
2: 0
3: 17
4: 137
Right 1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG 0: 1
1: 0
2: 4
3: 50
4: 361
1005990281_1005990284 -10 Left 1005990281 6:30897985-30898007 CCGGGCCCGGGGAGTGGGCTCTC 0: 1
1: 0
2: 1
3: 16
4: 212
Right 1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG 0: 1
1: 0
2: 4
3: 50
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005990284 Original CRISPR GTGGGCTCTCTCTCCTCTCC TGG Intronic
900074019 1:797525-797547 GTGGGATCCCCCTGCTCTCCAGG - Intergenic
900597954 1:3490959-3490981 GCCTGCTCTCTCTCCCCTCCAGG - Exonic
901153508 1:7120482-7120504 GCAGGCTCTCTCTCCCCTGCTGG - Intronic
901746507 1:11377190-11377212 ATGGGCTCTGTCTGCTCTGCTGG + Intergenic
901772931 1:11539891-11539913 GTGTGCTCTTTCCCCTCTCTGGG - Intergenic
901871362 1:12140853-12140875 CTGGGCCTTCTCTCCCCTCCTGG + Intronic
902956072 1:19924791-19924813 GTGGGTTTAGTCTCCTCTCCTGG - Intergenic
903742527 1:25566611-25566633 GTGGGTGCTCTGGCCTCTCCCGG + Intronic
903987056 1:27235687-27235709 TTGGGCTCTCTCTCCTCTGCGGG + Intronic
904279580 1:29409438-29409460 CTGGCCCCTCCCTCCTCTCCAGG - Intergenic
904623414 1:31789018-31789040 GTGTGCACTCCCTCCCCTCCAGG - Intergenic
906101874 1:43269191-43269213 GTAGGCTGTCCCTCATCTCCTGG - Intronic
906320168 1:44810690-44810712 GTGGGCACACGTTCCTCTCCAGG - Intronic
907620957 1:55979361-55979383 TTTGGCTCTCTCTTCTCTACTGG - Intergenic
908236485 1:62152038-62152060 TTGGTTTCTCTCTTCTCTCCTGG + Intronic
908534940 1:65067911-65067933 GCGCGCTCTCCCTCCTCTGCTGG + Intergenic
909736218 1:78966207-78966229 CTGGCCTCTCTCTCCTGTTCTGG + Intronic
911133873 1:94418641-94418663 GCGCGCTCTCTCTCCCCACCCGG + Intronic
913336638 1:117715239-117715261 GTGGACTCTCTCTGCTTCCCTGG - Intergenic
914195694 1:145446904-145446926 GGGGGCTCTCCCTGCTTTCCAGG + Intergenic
914326159 1:146618874-146618896 TAGGGCTCTCTCTCCTGTTCTGG + Intergenic
914344229 1:146784769-146784791 TTTGGCTCTCTCTCCTTTCTGGG + Intergenic
915103408 1:153516421-153516443 GGGGGCTCTGCCTCCACTCCAGG + Intergenic
915981223 1:160420989-160421011 GTGGCCTCTCTTCCCACTCCAGG - Intronic
916386230 1:164273682-164273704 ATGGGCTATCAGTCCTCTCCTGG + Intergenic
917222749 1:172748978-172749000 GTGGGCTCTCTCTCTGTTGCAGG + Intergenic
917465596 1:175273150-175273172 GTGGGCTGTCCCTACACTCCTGG - Intergenic
917587898 1:176446503-176446525 GTGCCCTCCCTCTCCTCTTCAGG + Intergenic
918003447 1:180520075-180520097 CTGGCCTCTCTCTCAACTCCAGG - Intergenic
918071679 1:181137797-181137819 GTGGCCTCCCTCTACTCTCTTGG + Intergenic
918794415 1:188874310-188874332 GTGTGCTCCCTCTCCTCTCAGGG - Intergenic
920264478 1:204711696-204711718 TTGGGGACCCTCTCCTCTCCAGG + Intergenic
922269872 1:224022430-224022452 GTGGGATCCCCCTGCTCTCCAGG - Intergenic
922532613 1:226356012-226356034 CTGTGCTCTCACTGCTCTCCTGG - Intergenic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1063144970 10:3288641-3288663 CTGGGCTCTTTCTCCCGTCCAGG + Intergenic
1063506767 10:6606833-6606855 ATGGGCTCTATCTCCTGACCTGG + Intergenic
1064152849 10:12879447-12879469 GTGGGCTCTCTCATCCCTCTGGG + Intergenic
1064429108 10:15256181-15256203 GTGGGCTTTATCTCCACTCCAGG + Intronic
1064634031 10:17345563-17345585 ATGCTCTCTCTCTCTTCTCCAGG - Intronic
1065373964 10:25017434-25017456 GTGTGTTTTCTCTCCTCTCCGGG - Intronic
1065974155 10:30827997-30828019 GTCGGCCCCCTCTCCTCCCCTGG - Intronic
1066047623 10:31607169-31607191 CTGGCCTGTGTCTCCTCTCCTGG + Intergenic
1067155733 10:43779862-43779884 GTAGGCCCTCTTTTCTCTCCAGG + Intergenic
1067835713 10:49639810-49639832 CTGCCCTCTTTCTCCTCTCCTGG + Intronic
1068283399 10:54906660-54906682 TTGGGCACTCTCTCTCCTCCAGG - Intronic
1070464808 10:76711051-76711073 GTGAGTTCTCTCTGCTTTCCTGG - Intergenic
1070606510 10:77902102-77902124 GTGGTCTCTGTCTCCCTTCCAGG + Intronic
1070945957 10:80391840-80391862 GTGAGCTCCCTCTCCTCTTCTGG - Intergenic
1071569403 10:86688419-86688441 GTGGGCTCTCTGGGCTCTGCTGG + Intronic
1072885074 10:99265726-99265748 GTGGACTCTCTCAGCTTTCCTGG - Intergenic
1073057458 10:100711501-100711523 GTGGGCTCCCTCTGGGCTCCAGG + Intergenic
1074343192 10:112654695-112654717 GTGGGCTCGATCTCCTGACCTGG + Intronic
1074899099 10:117801448-117801470 ATTGCCTCTCTCTCTTCTCCCGG - Intergenic
1074906151 10:117865581-117865603 GTGAGCACTCTCGCCTCTCTGGG + Intergenic
1074986323 10:118662888-118662910 GTGGGTTCTCTCGGCTTTCCTGG + Intergenic
1075786468 10:125053452-125053474 GAAGGCCCTCTGTCCTCTCCAGG + Intronic
1077674104 11:4182182-4182204 GGTGGCTCTCTGGCCTCTCCTGG + Intergenic
1081897362 11:46598041-46598063 CTGGGCTCTCTCTCCTTCCCTGG - Intergenic
1083430980 11:62613337-62613359 AAGGGCTCTGGCTCCTCTCCTGG + Exonic
1083771818 11:64871771-64871793 GTGGCCTCCCTCTCCCCTCCAGG - Intronic
1084189040 11:67490674-67490696 GAGGGCTCTCTCTCCCCTGTGGG + Intronic
1084973268 11:72782641-72782663 CTGGGCTCTCTTACCTCCCCAGG + Intronic
1085295257 11:75427910-75427932 GTGAAGTCTCTCTCCTCTCCAGG + Intronic
1085789729 11:79486620-79486642 GTGGGCTCACTCTCTTCTCCAGG + Intergenic
1087689071 11:101298181-101298203 GTGGGTTCTCTCAGCTTTCCTGG + Intergenic
1088877873 11:113950987-113951009 CTGGCCTCTCTCTCCTGTTCTGG - Intergenic
1089062659 11:115638566-115638588 GAAGCCTCTCTTTCCTCTCCAGG - Intergenic
1089294658 11:117460434-117460456 CTGGGCCCTCTCTTCTTTCCTGG - Intronic
1089302953 11:117509582-117509604 CTGGGCTCTCTTCCCCCTCCAGG - Intronic
1089745001 11:120610510-120610532 ATGAGCTCTCTCACCTGTCCTGG + Intronic
1089837272 11:121382203-121382225 GAGGGATCTCTCTTCCCTCCAGG - Intergenic
1089837761 11:121386344-121386366 CTGGGCTCTCTCACATGTCCAGG - Intergenic
1090602997 11:128391897-128391919 CTGGACTCTCTCTCCTCTTCAGG - Intergenic
1090874624 11:130777963-130777985 TTGGGCCTTCTCTCCTCTCTTGG - Intergenic
1091103092 11:132893816-132893838 GTGGGCTGTATCTCGTCTCCTGG + Intronic
1091133406 11:133165733-133165755 GCAGGCCCTCTCTCCTCCCCAGG + Intronic
1091564673 12:1639636-1639658 GCGGGTGCGCTCTCCTCTCCCGG - Intronic
1091744770 12:2984071-2984093 CTAGGCTCTTTCTCCACTCCTGG - Intronic
1092566228 12:9668421-9668443 TTTGGCCCTCTCTCCTCTCTGGG - Intronic
1092989381 12:13880318-13880340 GTGGGCTCTTGCTCCTGGCCAGG - Intronic
1092997751 12:13966013-13966035 CGGGGCTCTTTCTCCTCTGCAGG - Intronic
1093310015 12:17568517-17568539 GTGGGCTCTCTAGCCTGCCCTGG - Intergenic
1093758259 12:22876535-22876557 GTGGGTTCTCTCGGCTTTCCTGG + Intergenic
1094240431 12:28216508-28216530 GTGGACTTTGTCTACTCTCCCGG + Intronic
1094314878 12:29128747-29128769 CTGGCCTCTCTCTCCTTTCTGGG - Intergenic
1096654274 12:53079049-53079071 CTGGGCCCTGTCTCCTCCCCGGG + Intronic
1096683163 12:53270281-53270303 CTGGGCTCTGTCAGCTCTCCAGG + Intronic
1099041927 12:77667238-77667260 GTGGATTCTCTCGCCTTTCCTGG - Intergenic
1101097629 12:101359395-101359417 GTGCACTCTTTCTCCTCTCCTGG + Intronic
1101754226 12:107608272-107608294 GTTGGCTCTATCACATCTCCCGG + Intronic
1102203665 12:111075417-111075439 TTGGCCTCTCTCTGGTCTCCTGG + Intronic
1102769052 12:115457479-115457501 CTAGGCTCTTTCTCATCTCCAGG + Intergenic
1102799534 12:115719419-115719441 CTGGGCCCTTTCTCCTCTCCAGG - Intergenic
1103002770 12:117398032-117398054 GTGAGCTCTCTCTACACACCTGG + Intronic
1103320639 12:120090882-120090904 CTGCTCTCTCTCTTCTCTCCCGG + Intronic
1104314904 12:127688875-127688897 GTGGGCTGTCTCTACTCTTTTGG - Intergenic
1105284648 13:18994230-18994252 CTGGCCTCTGTCTTCTCTCCTGG - Intergenic
1105946745 13:25196887-25196909 GTGGGTTCGCTCCCCACTCCAGG + Intergenic
1105990550 13:25615939-25615961 GTGGATTCTCTCGACTCTCCTGG + Intronic
1106809787 13:33349216-33349238 GTTGCCTCTGTGTCCTCTCCAGG - Intronic
1107987248 13:45786116-45786138 GGGGGGTTTCTCCCCTCTCCTGG + Intronic
1110538583 13:76681669-76681691 GTAGGCTCACTCCCCTCTCATGG + Intergenic
1110639571 13:77806604-77806626 CTGGGCTCTCTTTCTGCTCCTGG + Intergenic
1111134713 13:84026062-84026084 GTGGGCTTTCTTTCCCCTGCTGG + Intergenic
1111766460 13:92536455-92536477 ATAGGCCCTCTCACCTCTCCTGG + Intronic
1111920334 13:94403150-94403172 GTGGCCACTCCCTGCTCTCCTGG + Exonic
1112938194 13:104826951-104826973 GAATGCTCTCCCTCCTCTCCTGG - Intergenic
1113511974 13:110863652-110863674 GTGAGCGGCCTCTCCTCTCCAGG + Intergenic
1113636754 13:111924801-111924823 GTCTGCCCTCTCTCATCTCCAGG - Intergenic
1113789550 13:113020609-113020631 GTGGGCTTGCTCTGCTCGCCTGG - Intronic
1113910252 13:113838320-113838342 TTGGGATCTCTCTCTGCTCCAGG - Intronic
1115147117 14:30238804-30238826 GAGGGCCCCCTCTCCTCACCAGG + Intergenic
1115199598 14:30838907-30838929 GTGGTCTCTCTCTGTTGTCCAGG - Intergenic
1117071700 14:52063303-52063325 GAGGCCCCTCTCTCCTCTCTGGG - Intronic
1117732743 14:58740260-58740282 GAGGGCTCTTTCTTCTCTCTTGG - Intergenic
1120847432 14:89138832-89138854 GTGGGGCTTCTCTGCTCTCCTGG + Intronic
1121276460 14:92671349-92671371 GAGTGCACTCTCCCCTCTCCAGG - Intronic
1121280096 14:92691881-92691903 GAGGGCTCCCTGGCCTCTCCTGG + Intergenic
1121503601 14:94459406-94459428 GTGGGTTCTCTCGGCTTTCCTGG + Intergenic
1121573169 14:94962566-94962588 GTGAGCTCTCTCTCCCCAGCGGG - Intergenic
1121683976 14:95818181-95818203 GTGGGTTCTCTCTCTTCACCTGG + Intergenic
1121705274 14:95988509-95988531 TTGGGCTCTCTCTGTGCTCCTGG + Intergenic
1122582473 14:102779231-102779253 GCCAGCTCTCTCTCCTTTCCTGG - Intronic
1123476517 15:20595325-20595347 GTGGGCTTTCCCACCCCTCCAGG + Intergenic
1123641494 15:22405039-22405061 GTGGGCTTTCCCACCCCTCCAGG - Intergenic
1124638012 15:31377173-31377195 GTGGCCTCTTGCTCCTCTCAGGG - Exonic
1124831570 15:33154206-33154228 GGCAGCTCTCTCTCCTCTGCAGG + Exonic
1126219703 15:46197975-46197997 GTGGGCCCTCACTCCACTCTGGG + Intergenic
1126815474 15:52449356-52449378 GTGTCATCTCTCACCTCTCCTGG + Intronic
1127622847 15:60751089-60751111 GTGGGCTGTCCCTGTTCTCCTGG - Intronic
1128114869 15:65098958-65098980 GGGGGCCCTCACTCCTCTGCAGG + Intronic
1128453767 15:67821761-67821783 GTGGGCTCTGTCTCCTCTGAGGG - Intronic
1128550419 15:68594776-68594798 AAGGGCTTTCTGTCCTCTCCAGG - Intronic
1128594446 15:68930864-68930886 GGGGTGTCCCTCTCCTCTCCTGG + Intronic
1129556501 15:76515872-76515894 ATGGGCTGTCTCTCCTCTTAAGG - Intronic
1131521127 15:93116520-93116542 GTGGGCTGTCTCCTCCCTCCTGG - Intergenic
1132343632 15:101093486-101093508 GGGGTCTCTCCTTCCTCTCCTGG + Intergenic
1132584931 16:701981-702003 GTGGCCTCTGTGTCCTCCCCAGG + Intronic
1132832517 16:1935739-1935761 GTGTGTCCTCTCTCCTCTCCAGG + Intergenic
1133279866 16:4659228-4659250 GTGGAGTCTCTGTCCTCTCCCGG + Intronic
1133806363 16:9128501-9128523 ATGGGCTCCCTCGCCTGTCCTGG + Intergenic
1133864865 16:9633059-9633081 GTGGGGTCACTCTGCTCTGCAGG + Intergenic
1134418630 16:14066696-14066718 GTGGTCTCTCTCTCATGCCCAGG + Intergenic
1135149454 16:19992757-19992779 CTGGGCTGTCTCTTCTCTGCTGG + Intergenic
1136280946 16:29210904-29210926 TTGGGTTGTCTCTCCTCTCAAGG - Intergenic
1138331408 16:56218725-56218747 GTGATCTCTCACTCATCTCCAGG + Intronic
1139383868 16:66551526-66551548 GAGGGGTTTCTCACCTCTCCCGG + Intronic
1139471236 16:67179211-67179233 CTGGGCTCGCTCTCATCTCTTGG - Intronic
1139989768 16:70930580-70930602 TTTGGCTCTCTCTCCTTTCTGGG - Intronic
1140007408 16:71092072-71092094 TAGGGCTCTCTCTCCTGTTCTGG - Intronic
1142013441 16:87729725-87729747 GTGTGCTATCACTGCTCTCCCGG + Intronic
1142085304 16:88176827-88176849 TTGGGTTGTCTCTCCTCTCAAGG - Intergenic
1142224702 16:88871838-88871860 ATGGGGTCACCCTCCTCTCCTGG + Intergenic
1143448664 17:7023037-7023059 GCGGGGTCTCTCTCCCCTCTTGG - Exonic
1144494715 17:15738919-15738941 GGTGGCTCTGTCACCTCTCCTGG - Intronic
1144905541 17:18637753-18637775 GGTGGCTCTGTCACCTCTCCTGG + Intronic
1146017542 17:29245895-29245917 GGGGGGTCTCTTTCCTCTCCTGG + Intergenic
1146302424 17:31699918-31699940 GTGCGCCCACTCTCTTCTCCAGG - Intergenic
1146372622 17:32275048-32275070 GTTGGCTCTCTCTCCTCTGGGGG + Intronic
1147685239 17:42283298-42283320 GTGCCCTCTCTCCTCTCTCCAGG + Intergenic
1148080286 17:44964165-44964187 CTGGGCTCTGCCTCCTCTCCGGG - Intronic
1148761085 17:50000980-50001002 GTGTTCTCTCCCTCCTTTCCTGG - Intergenic
1148989506 17:51653216-51653238 GTGAGATGTCTCTCCCCTCCAGG - Intronic
1149542463 17:57477938-57477960 TGTGGCTCTCTCTCCACTCCTGG - Intronic
1150161613 17:62902709-62902731 GTGTGCTCTCTCTCAACTCTGGG + Intergenic
1150620809 17:66806592-66806614 GTGGGATCTTCCTCCTCTCTGGG - Exonic
1151614974 17:75204081-75204103 ATGGTCTCTCTCTCCTGACCTGG + Intergenic
1152888065 17:82864357-82864379 GCCGGCTCTCTGTGCTCTCCAGG + Intronic
1152939091 17:83156689-83156711 GTGGGAACTCTCTCCTCTGGTGG - Intergenic
1153626286 18:7024925-7024947 GGAGGCTCTCGCACCTCTCCAGG + Intronic
1153753549 18:8258148-8258170 TTCTGCTCTTTCTCCTCTCCTGG - Intronic
1159958755 18:74539405-74539427 GTGGGCTCTTTCCCAGCTCCCGG + Intronic
1160234504 18:77075461-77075483 GTGGGTCCTCTGTCCCCTCCAGG + Intronic
1161025962 19:2037331-2037353 GTGGGGTCTGTCTCTGCTCCAGG - Intergenic
1161864462 19:6823961-6823983 GTGGTCTCACTCTCCCATCCAGG + Intronic
1161953799 19:7482043-7482065 GTGGGCCCTCTCTCTGCTCCTGG - Exonic
1163312221 19:16521468-16521490 GAGGCCTCTGTCCCCTCTCCCGG - Intronic
1163375096 19:16925213-16925235 GTGGTCTCTCTCTCCACCTCAGG + Exonic
1164703120 19:30300340-30300362 CTGGGGTCTCTTTGCTCTCCAGG + Intronic
1164916033 19:32053043-32053065 GTGGGCTCACCCTTCTCTCCAGG - Intergenic
1165006251 19:32809625-32809647 GTGGCCTCTCTGTCCACTTCTGG + Intronic
1165086109 19:33348697-33348719 ATGGGCTCTCTCTCTTGTCCTGG - Intergenic
1165169419 19:33880999-33881021 GTGGGCTCCCTCTTCTCCCCGGG + Intergenic
1165202464 19:34156295-34156317 GAGGTCTCCCTCTCCTGTCCAGG - Intergenic
1165412086 19:35668269-35668291 CTGGGCTGTCTCTTCTCTCCTGG + Intronic
1165824081 19:38695673-38695695 GTGGGCTCTGTCCCTTCTGCAGG + Intronic
1166542339 19:43613772-43613794 CTGTGCTCTCTCTCCTCGCTGGG - Exonic
1167154318 19:47729121-47729143 GATGGATCTGTCTCCTCTCCAGG - Intronic
1167346273 19:48947329-48947351 GTTGTCTCTCTGTCCTCTGCTGG - Intergenic
1167467767 19:49659134-49659156 CTGGGCACTGTCACCTCTCCTGG - Intergenic
1167757554 19:51421917-51421939 GTGGGCTCTCCATCCTCTCCAGG - Intergenic
1168308854 19:55451073-55451095 TCTGGCTCTCTCTCCTCTCAGGG - Intergenic
1168645277 19:58055485-58055507 GTGGGCTCCAGCTCCCCTCCTGG + Intergenic
925064942 2:922369-922391 CTGGGCACTCACTCCTCTGCTGG - Intergenic
925795725 2:7540031-7540053 GTGGGTTCTCTCAGCTTTCCTGG + Intergenic
926152322 2:10432177-10432199 GTGGGTTCTGTCTCCTCTTGGGG - Intergenic
926862675 2:17325558-17325580 GTGGCCTCTCTCTCTTTACCTGG - Intergenic
927065628 2:19468128-19468150 GAGGGCTCTCTCTCCAGTCAGGG - Intergenic
927612952 2:24560050-24560072 GAGGGCTCTCTCTGGTTTCCTGG + Intronic
927874712 2:26647660-26647682 GTGGGCTCTCCATCCTGGCCAGG - Intergenic
928372449 2:30750474-30750496 CTAGGCTCTCTCTCCTTTCATGG - Intronic
929317226 2:40494043-40494065 GTGTGCTTTCTCTCCTTTACAGG + Intronic
929460215 2:42097770-42097792 GTAGCCTCTCCCTCCTCTCTTGG + Intergenic
929885168 2:45871792-45871814 GAAGGCTGTCTCTCCTCTCTGGG - Intronic
930095096 2:47560862-47560884 GTGGGCTCTGTGGCCTCCCCTGG + Intronic
930946619 2:57084145-57084167 GTTGCCTCTCCATCCTCTCCTGG + Intergenic
931239779 2:60441716-60441738 CTGGGCTCCCACTCTTCTCCTGG - Intergenic
932703443 2:74005910-74005932 CTGGGCACTCACTCCTCTCCAGG - Intronic
934489727 2:94753399-94753421 GTGAGCTCTCTCTGTTCTCCTGG - Intergenic
934554666 2:95281068-95281090 CTGGGTTCTCCCTCCTCTCCAGG + Intronic
936524149 2:113231654-113231676 GTGTCCTCTCTCCTCTCTCCTGG + Intronic
936713619 2:115161452-115161474 GGGGGCTCTCGCGCCGCTCCGGG + Intronic
937150575 2:119683112-119683134 ACTGGCTCACTCTCCTCTCCAGG - Intronic
937982595 2:127624158-127624180 GCTGGCTCTCGCCCCTCTCCTGG - Exonic
938512572 2:131966405-131966427 GCCGGCTCCCTCTGCTCTCCGGG + Intergenic
942114202 2:172712370-172712392 CTGGGCTCTTTCTGCTCTCTTGG + Intergenic
942295903 2:174517006-174517028 GAGGACACTCTCTCCTCTTCTGG - Intergenic
943664216 2:190591715-190591737 GTGGGCTTTCTTTAGTCTCCAGG - Intergenic
944176227 2:196831505-196831527 GTGGGATGTATCTCCTCTCTTGG + Intergenic
944237092 2:197450677-197450699 GCCGGCTCTCTCTGCTCGCCGGG + Intergenic
944934794 2:204556615-204556637 GTGTGCACCCACTCCTCTCCAGG - Intronic
945209405 2:207366743-207366765 TTGAGCTCTCTCTCCTTCCCTGG - Intergenic
945218756 2:207463334-207463356 CTGGTCTCTCTCTCCTGACCTGG - Intergenic
945515144 2:210754220-210754242 GTAGGCTGTCTTTCCTCTACTGG + Intergenic
946114188 2:217447185-217447207 GTGGTCTCTCTCTTCTCTCAAGG + Intronic
946433597 2:219638291-219638313 GTGGGCTCCCTCTCCTGGCCTGG - Intronic
947148121 2:227087093-227087115 GAGGGCTCTCTCCAGTCTCCAGG + Intronic
947616021 2:231557415-231557437 GTGGGTGCTCCTTCCTCTCCTGG + Intergenic
948505449 2:238424596-238424618 GTGGGCTGTCTTGCCCCTCCAGG - Intergenic
948531062 2:238605995-238606017 GTGGGCTCTCTTGGCTTTCCTGG - Intergenic
948763842 2:240209508-240209530 GGTGGCTGTCCCTCCTCTCCCGG + Intergenic
948788620 2:240365749-240365771 GTGGGCACCCACCCCTCTCCTGG + Intergenic
948965053 2:241372748-241372770 CTGGGCTCTCTTGCCTCTGCTGG + Intronic
949007729 2:241659345-241659367 GTGGCCTCGCTCTCCTATCCCGG + Intronic
949049952 2:241892331-241892353 CTGGCGTCCCTCTCCTCTCCTGG + Intergenic
1168955983 20:1834729-1834751 GGGGGCTCTCTCTTATCTCCTGG - Intergenic
1169046482 20:2537780-2537802 TTGGGCTCTCCCACTTCTCCTGG - Intronic
1171303710 20:24086251-24086273 GAGCGCTCTCATTCCTCTCCTGG + Intergenic
1171727316 20:28636890-28636912 GTGAGCTTTCTGTCCTCTGCAGG - Intergenic
1172220785 20:33273404-33273426 GTTGCCTCTTTCTCCCCTCCTGG + Intergenic
1172644432 20:36461241-36461263 GTGGGCGCGCGCTCCTTTCCTGG + Intronic
1172702787 20:36863251-36863273 GGTGGCTCTTTTTCCTCTCCGGG + Exonic
1174522137 20:51139825-51139847 GTGGGCTCTCCCTATTCCCCAGG - Intergenic
1175873163 20:62217807-62217829 GTGGTCTCTCCCTCCTTTCCTGG - Intronic
1175987567 20:62771542-62771564 CTGGGGTCTCTGCCCTCTCCGGG + Intergenic
1178011047 21:28287642-28287664 CTGGGCTAACTCTCCTCTTCTGG + Intergenic
1178521163 21:33289448-33289470 GAGGGCCCGCTCTCCTCTCCCGG + Intronic
1178686504 21:34715452-34715474 GAAGGCTCTCTCTCCACTTCTGG - Intronic
1178695346 21:34787959-34787981 GTGGGCCGCCTCCCCTCTCCTGG - Exonic
1179245539 21:39630961-39630983 GCGTGCTTCCTCTCCTCTCCAGG - Intronic
1180002152 21:45000076-45000098 GTGGGCTCTCAGTCCATTCCTGG + Intergenic
1180857792 22:19059253-19059275 GTGGCCTCTGTCTGGTCTCCTGG - Intronic
1181421008 22:22799018-22799040 GTGAACTCTCCCTCCCCTCCTGG + Intronic
1181654825 22:24287987-24288009 AAGGGCTCTCTCTGATCTCCCGG - Intronic
1181708982 22:24668672-24668694 AAGGGCTCTCTCTGATCTCCCGG - Intergenic
1182158732 22:28100727-28100749 GAGGGATCTTTCTACTCTCCAGG + Intronic
1183061822 22:35340829-35340851 AAGGGCACTCTCTCCGCTCCTGG + Intronic
1183525080 22:38317769-38317791 CCAGGATCTCTCTCCTCTCCAGG + Intronic
949766959 3:7537184-7537206 TTGGGTTCTCTCTCCTCTTTTGG + Intronic
950043154 3:9933159-9933181 GTGGTCTTGCTCTTCTCTCCCGG + Exonic
950414415 3:12860483-12860505 GTGGGGGCTCTCTCTGCTCCTGG - Intronic
951050797 3:18090460-18090482 GAGGGCTCTTTTTCCTCTACAGG - Intronic
951140036 3:19148210-19148232 TTGCGCTCGCTCTCCTTTCCCGG + Intergenic
951510153 3:23491541-23491563 CTGGGCTCTTTCTTGTCTCCTGG - Intronic
951621778 3:24609640-24609662 GTGGTCTTTCTCTCCTCACCAGG + Intergenic
953772814 3:45791997-45792019 GTGTGCTCTTCATCCTCTCCAGG - Intronic
954159633 3:48711552-48711574 CTGGGCTCTCTCTCCTTTAGAGG + Intronic
954414714 3:50387612-50387634 GAGGCCTCTCTCCCCTCACCAGG - Exonic
954605867 3:51908751-51908773 GAGAGCTCTCTCTGCTGTCCAGG - Intergenic
955094316 3:55782160-55782182 GTGGGCTGTCTCTCCTGCACAGG - Intronic
956394833 3:68814266-68814288 ATGGCCTCTCTCACCACTCCTGG + Intronic
957646593 3:82939044-82939066 CTGGGCTCTCTCCCTGCTCCTGG + Intergenic
959361689 3:105402363-105402385 GTGGATTCTCTCTGCTTTCCTGG - Intronic
960056725 3:113281164-113281186 TTGGGTTCTCTCTCCTGTCTTGG + Intronic
960325958 3:116296463-116296485 GTGGTCTCTGTCTCCTGACCTGG - Intronic
960936092 3:122903542-122903564 GCGGGATGTCTCTCCTCTTCTGG + Intergenic
961013674 3:123450970-123450992 GTGTGGTCTCCCACCTCTCCAGG - Intergenic
961088527 3:124090565-124090587 GAGGGGCCTCTCTCCTCTCAAGG - Intronic
961165834 3:124763298-124763320 CTGGGCTGTCTCTCCCTTCCAGG - Exonic
961506912 3:127376070-127376092 GTGGGGGCTCCCTGCTCTCCAGG + Intergenic
962251423 3:133838333-133838355 GTGGGCTCCCTCTGCCCTGCTGG - Intronic
962391767 3:134978244-134978266 TTGGGCTCTCTCTTGTCTTCCGG + Intronic
963503777 3:146160756-146160778 GGGGCCTGTCCCTCCTCTCCAGG - Intronic
963607174 3:147421335-147421357 GAGGGCTCTGAGTCCTCTCCCGG + Intronic
964548331 3:157859489-157859511 ATGGGCTCACTCTGCTCCCCAGG - Intergenic
967087866 3:186110290-186110312 GGCGGCTCTATCTTCTCTCCGGG + Intronic
967171669 3:186827088-186827110 GGGTGCTTTCTCTCCTCTCCAGG - Intergenic
968134072 3:196209101-196209123 GAGGGCTGCCTCTCCTCCCCTGG + Intronic
968230452 3:197002480-197002502 GTGAGCTCCGTCTCCTCACCCGG - Exonic
968462138 4:731478-731500 CAGGGCTATCTCTCCCCTCCCGG + Intronic
968940635 4:3635683-3635705 GTGGGCTCTCACGTCACTCCAGG - Intergenic
969328105 4:6455599-6455621 GGGGGCTTTCTCACCTCTGCTGG + Intronic
969549167 4:7852937-7852959 AGGGGCTCTGTCTCCTCTGCGGG + Intronic
972276548 4:37563460-37563482 GAGTGCTCTCTCTCCTCTTAAGG + Intronic
973316101 4:48762015-48762037 GTTAGCTCTCTTGCCTCTCCTGG - Intronic
973604354 4:52571697-52571719 GGAGCCTCTCTCTCCTCTTCTGG + Intergenic
974164963 4:58190500-58190522 GTGGATTCTCTCACCTTTCCTGG - Intergenic
974446399 4:61988754-61988776 GTGTGCTCTCTCCCTTTTCCTGG - Intronic
976351890 4:84069371-84069393 TTGGGCATGCTCTCCTCTCCTGG + Intergenic
977635487 4:99293435-99293457 GTGGATTCTCTCTGCTTTCCTGG - Intergenic
979600411 4:122581234-122581256 GTGGGGTCACTTTCCTATCCAGG + Intergenic
980263206 4:130481436-130481458 GTGGATTCTCTCTGCTTTCCTGG - Intergenic
985664205 5:1173567-1173589 GTGGGCACTCTCTGCCCACCAGG - Intergenic
985842312 5:2317594-2317616 GTGGGCACTCTGGCTTCTCCTGG + Intergenic
985895477 5:2748297-2748319 GCTGGCTCTCCCTCCCCTCCCGG + Intronic
986036636 5:3947000-3947022 GTGGGCTGGCTCTTCTCACCTGG + Intergenic
989076939 5:37573843-37573865 GTTAGTTCTCTCTCCTTTCCTGG + Intronic
991925675 5:71703034-71703056 CTGGGTTCCCTCCCCTCTCCAGG - Intergenic
992140634 5:73793570-73793592 GTGGGGTCTCACTCCTTTTCTGG - Intronic
992380299 5:76229658-76229680 ATGTCCTCTCTCTCCTCTGCTGG - Intronic
992837428 5:80654673-80654695 GCGGGCTCGCGCTCCTCGCCAGG + Exonic
993885794 5:93413431-93413453 GTGGGCTCTCTCATCTCTTCAGG + Intergenic
997207096 5:132056459-132056481 TTGGGCTGGCTCTCCTGTCCGGG + Intergenic
997234830 5:132266737-132266759 GTGGGCTCTGTCTCTACTCCGGG + Intronic
997350096 5:133224904-133224926 CTGGGCTCTGTCTGCTGTCCAGG + Intronic
997618930 5:135272402-135272424 CTGGGCTCTCCCTCTTCTCAGGG + Intronic
997759070 5:136427504-136427526 CTGGGCTCTCTCTTCACCCCAGG + Intergenic
998038418 5:138935722-138935744 GGGGGCTCCTTCTCCTTTCCTGG + Intergenic
998772687 5:145564482-145564504 GCTGGCTCCCTCTCATCTCCAGG + Intronic
999173678 5:149616699-149616721 GAGGGCTGTCTCTGCCCTCCAGG + Exonic
999508540 5:152223702-152223724 GTGGTTGCTCTTTCCTCTCCTGG + Intergenic
999623072 5:153491524-153491546 GTAGGCTCCCTCTCCTGTTCTGG + Intronic
999868776 5:155728900-155728922 TTGGTGTCTCGCTCCTCTCCTGG - Intergenic
1001309841 5:170602930-170602952 GTGAGCACACTCTCCTCCCCTGG + Intronic
1001501190 5:172236083-172236105 CTGGGCTATCTCTACTCTCCAGG + Intronic
1001893466 5:175359110-175359132 TTGGGCTCACTGTCCTCTCTGGG - Intergenic
1002322263 5:178382972-178382994 GTGGAGTCTCTCACCTCCCCAGG - Intronic
1002435318 5:179227781-179227803 CTCGGCCATCTCTCCTCTCCTGG - Intronic
1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG + Intronic
1006745712 6:36340697-36340719 GTGAACTCTCACTCCTTTCCCGG + Intergenic
1006806289 6:36791822-36791844 GTGAGCTCCTTCTCCTCTCCGGG + Intronic
1007395114 6:41573299-41573321 GGGGTCTCTCTCTCCCCTCCAGG - Intronic
1010939388 6:81897758-81897780 GTGGGTTCTCTTTCCTTCCCAGG - Intergenic
1011649981 6:89496546-89496568 GGAGTCTCTCTCTCTTCTCCAGG + Intronic
1012837310 6:104285933-104285955 GTTGGCTTTCTCACCTCTCTTGG - Intergenic
1013314260 6:108925902-108925924 GTGGGCTTTCTCTCCTGACTTGG + Intronic
1013709423 6:112879945-112879967 GCCCGGTCTCTCTCCTCTCCTGG - Intergenic
1014777195 6:125524728-125524750 GTGGCCCCTCTTTCCTGTCCAGG - Intergenic
1018373175 6:163186983-163187005 ACGGGCTCTGTCTCCTCTCCAGG + Intronic
1018711101 6:166498735-166498757 GTGGGCTCTGCCCCCTCTCCAGG + Intronic
1018971138 6:168530254-168530276 AAGGGCTTTCTCTGCTCTCCAGG - Intronic
1022316369 7:29248900-29248922 GTGTGCCCTCTCTCATCACCAGG + Intronic
1023520660 7:41047033-41047055 GCTGGCTCTCTCTCTTCTTCTGG - Intergenic
1024453641 7:49578810-49578832 TTGTGATCTCTCTCCTCTCCTGG + Intergenic
1024455644 7:49604297-49604319 GTGGATTCTCTCTGCTTTCCTGG - Intergenic
1024473531 7:49787836-49787858 CTGGGCTCCCAGTCCTCTCCAGG + Intronic
1024575896 7:50763969-50763991 GTGGCCCCTGCCTCCTCTCCAGG + Intronic
1025090549 7:56059712-56059734 GTGGGGTCTCACTCCTGCCCGGG + Intronic
1025820519 7:64958743-64958765 GTGGGTTCTCTCAGCTTTCCTGG - Intergenic
1028127630 7:87132095-87132117 GTGGGCTGTCTCTTCACTTCTGG - Intergenic
1030349608 7:108469128-108469150 CTGGGCTCTCTCTACCCTCTAGG + Intergenic
1030927560 7:115477238-115477260 GTGGGGTCAGACTCCTCTCCAGG + Intergenic
1031038042 7:116809273-116809295 TTGGGCTCTCTCTACACTCCTGG - Intergenic
1031044916 7:116876817-116876839 GTGTGCTGTCTCCTCTCTCCTGG - Intronic
1031962009 7:127998666-127998688 GAGGGCCCTCTCTTCTCTCTAGG - Intronic
1032148498 7:129406356-129406378 GTGTGCTCTCTCCCCTCTTCAGG + Exonic
1033311867 7:140267615-140267637 GGTGGCTCTCTCTCAGCTCCAGG + Intergenic
1033344895 7:140519027-140519049 CTGGGCACTTTCTCCTCCCCTGG - Intronic
1034330404 7:150277727-150277749 CTGGAGCCTCTCTCCTCTCCCGG + Intronic
1034667639 7:152832121-152832143 CTGGAGCCTCTCTCCTCTCCCGG - Intronic
1035065827 7:156104659-156104681 GTGAGCTGTTTCTCCTCTCAGGG + Intergenic
1035476752 7:159149307-159149329 GGTGTCTCTTTCTCCTCTCCTGG + Intergenic
1037892425 8:22630337-22630359 GTGGGCTCCCTCTGCTCTCAGGG - Intronic
1041187136 8:55312907-55312929 GTGGACTCTGTCTCCTCCCTAGG + Intronic
1041870469 8:62628219-62628241 GTGGGCCCGCTTTCCTCTCCAGG - Intronic
1042399954 8:68333014-68333036 GTGTTTTCTCTCTACTCTCCTGG + Intronic
1042737038 8:72001129-72001151 ATGGGCTATGTCTCCTCTGCTGG - Intronic
1044788250 8:95819153-95819175 GTGGGTTCTCTCAGCTTTCCTGG + Intergenic
1045406934 8:101875878-101875900 GTGGAACATCTCTCCTCTCCAGG + Intronic
1046319936 8:112559389-112559411 GCTTTCTCTCTCTCCTCTCCTGG - Intronic
1047513028 8:125529812-125529834 GTGGGCACCCTCTCCCCACCTGG - Intergenic
1047662498 8:127052663-127052685 GTGGGCAATCTGTCCTCTCAAGG + Intergenic
1047748693 8:127864262-127864284 GCAGGCTCTCTCCCCTCCCCAGG - Intergenic
1048333507 8:133486750-133486772 GTGGGTGTTCTCTCCTCTCCTGG - Intronic
1048544581 8:135374582-135374604 CTGGGCTCGCTCCCCTCACCAGG + Intergenic
1049056097 8:140238838-140238860 GGGGCCTCTCTCTCCATTCCAGG - Intronic
1049317058 8:141975053-141975075 GGGGCCTCTCCTTCCTCTCCAGG + Intergenic
1049483086 8:142836685-142836707 GTGTGCCCTCTCCTCTCTCCAGG + Intronic
1049605022 8:143525360-143525382 GTGGGCGCGGTCTCCTCTTCAGG + Intronic
1051265733 9:15307009-15307031 CCGGGCTCACTCTTCTCTCCCGG + Intronic
1052540393 9:29804180-29804202 GTGGCCTCTTTCTACTTTCCAGG - Intergenic
1052832034 9:33223495-33223517 TGGGGCTCTCTCTGCTCTTCTGG + Intronic
1053380965 9:37649860-37649882 GTGGGATCTCTCTCATCTTGGGG + Intronic
1055612142 9:78033519-78033541 GTTTGCCCTCTCTGCTCTCCAGG - Intergenic
1056191647 9:84190120-84190142 CTGGCCTCTCTCTCCTGTTCTGG + Intergenic
1056580758 9:87886916-87886938 GTGGGCTTTCCCACCCCTCCAGG - Exonic
1056761519 9:89418955-89418977 GGCGGCTCTCCCTCCTCTACAGG + Intronic
1057140349 9:92722944-92722966 CTGGGCTCCCTCTCCTCTCCAGG - Intronic
1058069364 9:100586037-100586059 TTAGCCTCTCTCTCCTCTCCGGG - Exonic
1059068814 9:111113565-111113587 ATGGGGTCTCTCTCTTCCCCAGG - Intergenic
1060103956 9:120862146-120862168 GAGGACTCTCCCTCCTCCCCAGG - Intronic
1061916734 9:133759475-133759497 GAGGTCTCTCCCTCCTCTCATGG - Intergenic
1061933539 9:133845473-133845495 GCGAGATCTCTCTCCTCTCTAGG + Intronic
1062056894 9:134473503-134473525 GTGGGCTCCCTCACCTGGCCTGG + Intergenic
1062368409 9:136223205-136223227 GAGGCCTTTCTCTCGTCTCCGGG + Intronic
1062401722 9:136375750-136375772 GTGGGCTGTCTCTCGTCAGCAGG + Exonic
1062698972 9:137889446-137889468 GGGGGCTCTCCCTGCTTTCCAGG - Intronic
1203759376 EBV:4139-4161 GTGGCCTCTGTCTCCGCCCCAGG + Intergenic
1185776811 X:2809808-2809830 GTGGGCTCTCACATCCCTCCAGG + Intronic
1187503519 X:19859770-19859792 TTGGGCTCCCTGTCCCCTCCTGG + Intronic
1189308620 X:40005476-40005498 GCTGGCTCTCCCTCCCCTCCCGG + Intergenic
1192186280 X:68948786-68948808 GTTAGCTCTCCCTCCTCTCGTGG - Intergenic
1194164920 X:90504053-90504075 GGGTGCTCTCTCTCCTCTTTAGG + Intergenic
1195012756 X:100749506-100749528 GTGGTCTCTCCCTCATCTTCAGG - Intergenic
1196948947 X:120856962-120856984 GTGGATTCTCTCTCCTTTGCTGG - Intergenic
1197251060 X:124216923-124216945 CTGGGAACTCTTTCCTCTCCTGG + Intronic
1197463290 X:126770904-126770926 GTGGATTCTCTCTGCTTTCCTGG - Intergenic
1198090268 X:133321927-133321949 TTGTTCTCTCTCTCATCTCCAGG - Intronic
1198624392 X:138553314-138553336 ATGGCCTCTCTCACCTCTCATGG + Intergenic
1198806523 X:140500551-140500573 GAGGGTACTCTCTCCTCTGCCGG - Intergenic
1198809855 X:140524365-140524387 GTGGGTTCTCTCTTCTGTACAGG + Intergenic
1199609406 X:149600168-149600190 CTGTGTTCTCTCCCCTCTCCTGG + Intronic
1199629711 X:149769186-149769208 CTGTGTTCTCTCCCCTCTCCTGG - Intergenic
1199738760 X:150711649-150711671 CTGGGCTTTCCCTCCTCTCCGGG + Intronic
1199913597 X:152315093-152315115 GTGGGTTCTCTCAGCTTTCCTGG - Intronic