ID: 1005991799

View in Genome Browser
Species Human (GRCh38)
Location 6:30907882-30907904
Sequence CGCCAGAGCGCGCCTCCGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005991795_1005991799 23 Left 1005991795 6:30907836-30907858 CCAATTTTATGGGGAGTAATTGT No data
Right 1005991799 6:30907882-30907904 CGCCAGAGCGCGCCTCCGCAAGG No data
1005991794_1005991799 24 Left 1005991794 6:30907835-30907857 CCCAATTTTATGGGGAGTAATTG No data
Right 1005991799 6:30907882-30907904 CGCCAGAGCGCGCCTCCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005991799 Original CRISPR CGCCAGAGCGCGCCTCCGCA AGG Intergenic
No off target data available for this crispr