ID: 1005992813

View in Genome Browser
Species Human (GRCh38)
Location 6:30914122-30914144
Sequence CGAAGGCAAACCCCACGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 71}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005992813_1005992828 27 Left 1005992813 6:30914122-30914144 CCTCCCCGTGGGGTTTGCCTTCG 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1005992828 6:30914172-30914194 CCTTTGGACCGGTAGGGAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 87
1005992813_1005992823 16 Left 1005992813 6:30914122-30914144 CCTCCCCGTGGGGTTTGCCTTCG 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1005992823 6:30914161-30914183 CTGGTCTACAGCCTTTGGACCGG 0: 1
1: 0
2: 0
3: 11
4: 118
1005992813_1005992824 20 Left 1005992813 6:30914122-30914144 CCTCCCCGTGGGGTTTGCCTTCG 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1005992824 6:30914165-30914187 TCTACAGCCTTTGGACCGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 67
1005992813_1005992825 21 Left 1005992813 6:30914122-30914144 CCTCCCCGTGGGGTTTGCCTTCG 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1005992825 6:30914166-30914188 CTACAGCCTTTGGACCGGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 35
1005992813_1005992820 -3 Left 1005992813 6:30914122-30914144 CCTCCCCGTGGGGTTTGCCTTCG 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1005992820 6:30914142-30914164 TCGCGGCGGACTCGCTCCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 26
1005992813_1005992829 30 Left 1005992813 6:30914122-30914144 CCTCCCCGTGGGGTTTGCCTTCG 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1005992829 6:30914175-30914197 TTGGACCGGTAGGGAGAGGGTGG 0: 1
1: 0
2: 1
3: 16
4: 173
1005992813_1005992826 26 Left 1005992813 6:30914122-30914144 CCTCCCCGTGGGGTTTGCCTTCG 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1005992826 6:30914171-30914193 GCCTTTGGACCGGTAGGGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 118
1005992813_1005992821 11 Left 1005992813 6:30914122-30914144 CCTCCCCGTGGGGTTTGCCTTCG 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1005992821 6:30914156-30914178 CTCCTCTGGTCTACAGCCTTTGG 0: 1
1: 0
2: 1
3: 25
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005992813 Original CRISPR CGAAGGCAAACCCCACGGGG AGG (reversed) Intronic