ID: 1005992814

View in Genome Browser
Species Human (GRCh38)
Location 6:30914125-30914147
Sequence CCGCGAAGGCAAACCCCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005992814_1005992825 18 Left 1005992814 6:30914125-30914147 CCCCGTGGGGTTTGCCTTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1005992825 6:30914166-30914188 CTACAGCCTTTGGACCGGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 35
1005992814_1005992820 -6 Left 1005992814 6:30914125-30914147 CCCCGTGGGGTTTGCCTTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1005992820 6:30914142-30914164 TCGCGGCGGACTCGCTCCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 26
1005992814_1005992823 13 Left 1005992814 6:30914125-30914147 CCCCGTGGGGTTTGCCTTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1005992823 6:30914161-30914183 CTGGTCTACAGCCTTTGGACCGG 0: 1
1: 0
2: 0
3: 11
4: 118
1005992814_1005992831 29 Left 1005992814 6:30914125-30914147 CCCCGTGGGGTTTGCCTTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1005992831 6:30914177-30914199 GGACCGGTAGGGAGAGGGTGGGG 0: 1
1: 0
2: 3
3: 32
4: 711
1005992814_1005992821 8 Left 1005992814 6:30914125-30914147 CCCCGTGGGGTTTGCCTTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1005992821 6:30914156-30914178 CTCCTCTGGTCTACAGCCTTTGG 0: 1
1: 0
2: 1
3: 25
4: 175
1005992814_1005992830 28 Left 1005992814 6:30914125-30914147 CCCCGTGGGGTTTGCCTTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1005992830 6:30914176-30914198 TGGACCGGTAGGGAGAGGGTGGG 0: 1
1: 0
2: 2
3: 12
4: 233
1005992814_1005992824 17 Left 1005992814 6:30914125-30914147 CCCCGTGGGGTTTGCCTTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1005992824 6:30914165-30914187 TCTACAGCCTTTGGACCGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 67
1005992814_1005992826 23 Left 1005992814 6:30914125-30914147 CCCCGTGGGGTTTGCCTTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1005992826 6:30914171-30914193 GCCTTTGGACCGGTAGGGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 118
1005992814_1005992829 27 Left 1005992814 6:30914125-30914147 CCCCGTGGGGTTTGCCTTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1005992829 6:30914175-30914197 TTGGACCGGTAGGGAGAGGGTGG 0: 1
1: 0
2: 1
3: 16
4: 173
1005992814_1005992828 24 Left 1005992814 6:30914125-30914147 CCCCGTGGGGTTTGCCTTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1005992828 6:30914172-30914194 CCTTTGGACCGGTAGGGAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005992814 Original CRISPR CCGCGAAGGCAAACCCCACG GGG (reversed) Intronic