ID: 1005992822

View in Genome Browser
Species Human (GRCh38)
Location 6:30914158-30914180
Sequence GTCCAAAGGCTGTAGACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 177}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005992822_1005992837 29 Left 1005992822 6:30914158-30914180 CCTCTGGTCTACAGCCTTTGGAC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1005992837 6:30914210-30914232 CTGCTGCGCATGCGCCGGCCGGG 0: 1
1: 0
2: 6
3: 14
4: 99
1005992822_1005992838 30 Left 1005992822 6:30914158-30914180 CCTCTGGTCTACAGCCTTTGGAC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1005992838 6:30914211-30914233 TGCTGCGCATGCGCCGGCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1005992822_1005992834 24 Left 1005992822 6:30914158-30914180 CCTCTGGTCTACAGCCTTTGGAC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1005992834 6:30914205-30914227 GCCAGCTGCTGCGCATGCGCCGG 0: 1
1: 0
2: 1
3: 20
4: 160
1005992822_1005992836 28 Left 1005992822 6:30914158-30914180 CCTCTGGTCTACAGCCTTTGGAC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1005992836 6:30914209-30914231 GCTGCTGCGCATGCGCCGGCCGG 0: 1
1: 0
2: 1
3: 9
4: 114
1005992822_1005992828 -9 Left 1005992822 6:30914158-30914180 CCTCTGGTCTACAGCCTTTGGAC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1005992828 6:30914172-30914194 CCTTTGGACCGGTAGGGAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 87
1005992822_1005992831 -4 Left 1005992822 6:30914158-30914180 CCTCTGGTCTACAGCCTTTGGAC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1005992831 6:30914177-30914199 GGACCGGTAGGGAGAGGGTGGGG 0: 1
1: 0
2: 3
3: 32
4: 711
1005992822_1005992829 -6 Left 1005992822 6:30914158-30914180 CCTCTGGTCTACAGCCTTTGGAC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1005992829 6:30914175-30914197 TTGGACCGGTAGGGAGAGGGTGG 0: 1
1: 0
2: 1
3: 16
4: 173
1005992822_1005992830 -5 Left 1005992822 6:30914158-30914180 CCTCTGGTCTACAGCCTTTGGAC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1005992830 6:30914176-30914198 TGGACCGGTAGGGAGAGGGTGGG 0: 1
1: 0
2: 2
3: 12
4: 233
1005992822_1005992826 -10 Left 1005992822 6:30914158-30914180 CCTCTGGTCTACAGCCTTTGGAC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1005992826 6:30914171-30914193 GCCTTTGGACCGGTAGGGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005992822 Original CRISPR GTCCAAAGGCTGTAGACCAG AGG (reversed) Intronic