ID: 1005992824

View in Genome Browser
Species Human (GRCh38)
Location 6:30914165-30914187
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005992814_1005992824 17 Left 1005992814 6:30914125-30914147 CCCCGTGGGGTTTGCCTTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1005992824 6:30914165-30914187 TCTACAGCCTTTGGACCGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 67
1005992817_1005992824 15 Left 1005992817 6:30914127-30914149 CCGTGGGGTTTGCCTTCGCGGCG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1005992824 6:30914165-30914187 TCTACAGCCTTTGGACCGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 67
1005992813_1005992824 20 Left 1005992813 6:30914122-30914144 CCTCCCCGTGGGGTTTGCCTTCG 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1005992824 6:30914165-30914187 TCTACAGCCTTTGGACCGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 67
1005992811_1005992824 28 Left 1005992811 6:30914114-30914136 CCCGGGCGCCTCCCCGTGGGGTT 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1005992824 6:30914165-30914187 TCTACAGCCTTTGGACCGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 67
1005992816_1005992824 16 Left 1005992816 6:30914126-30914148 CCCGTGGGGTTTGCCTTCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 38
Right 1005992824 6:30914165-30914187 TCTACAGCCTTTGGACCGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 67
1005992812_1005992824 27 Left 1005992812 6:30914115-30914137 CCGGGCGCCTCCCCGTGGGGTTT 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1005992824 6:30914165-30914187 TCTACAGCCTTTGGACCGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 67
1005992819_1005992824 3 Left 1005992819 6:30914139-30914161 CCTTCGCGGCGGACTCGCTCCTC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1005992824 6:30914165-30914187 TCTACAGCCTTTGGACCGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type