ID: 1005992826

View in Genome Browser
Species Human (GRCh38)
Location 6:30914171-30914193
Sequence GCCTTTGGACCGGTAGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 118}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005992817_1005992826 21 Left 1005992817 6:30914127-30914149 CCGTGGGGTTTGCCTTCGCGGCG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1005992826 6:30914171-30914193 GCCTTTGGACCGGTAGGGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 118
1005992816_1005992826 22 Left 1005992816 6:30914126-30914148 CCCGTGGGGTTTGCCTTCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 38
Right 1005992826 6:30914171-30914193 GCCTTTGGACCGGTAGGGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 118
1005992814_1005992826 23 Left 1005992814 6:30914125-30914147 CCCCGTGGGGTTTGCCTTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1005992826 6:30914171-30914193 GCCTTTGGACCGGTAGGGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 118
1005992822_1005992826 -10 Left 1005992822 6:30914158-30914180 CCTCTGGTCTACAGCCTTTGGAC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1005992826 6:30914171-30914193 GCCTTTGGACCGGTAGGGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 118
1005992819_1005992826 9 Left 1005992819 6:30914139-30914161 CCTTCGCGGCGGACTCGCTCCTC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1005992826 6:30914171-30914193 GCCTTTGGACCGGTAGGGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 118
1005992813_1005992826 26 Left 1005992813 6:30914122-30914144 CCTCCCCGTGGGGTTTGCCTTCG 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1005992826 6:30914171-30914193 GCCTTTGGACCGGTAGGGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005992826 Original CRISPR GCCTTTGGACCGGTAGGGAG AGG Intronic