ID: 1005992827

View in Genome Browser
Species Human (GRCh38)
Location 6:30914172-30914194
Sequence CCCTCTCCCTACCGGTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005992827_1005992838 16 Left 1005992827 6:30914172-30914194 CCTTTGGACCGGTAGGGAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1005992838 6:30914211-30914233 TGCTGCGCATGCGCCGGCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1005992827_1005992834 10 Left 1005992827 6:30914172-30914194 CCTTTGGACCGGTAGGGAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1005992834 6:30914205-30914227 GCCAGCTGCTGCGCATGCGCCGG 0: 1
1: 0
2: 1
3: 20
4: 160
1005992827_1005992836 14 Left 1005992827 6:30914172-30914194 CCTTTGGACCGGTAGGGAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1005992836 6:30914209-30914231 GCTGCTGCGCATGCGCCGGCCGG 0: 1
1: 0
2: 1
3: 9
4: 114
1005992827_1005992837 15 Left 1005992827 6:30914172-30914194 CCTTTGGACCGGTAGGGAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1005992837 6:30914210-30914232 CTGCTGCGCATGCGCCGGCCGGG 0: 1
1: 0
2: 6
3: 14
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005992827 Original CRISPR CCCTCTCCCTACCGGTCCAA AGG (reversed) Intronic