ID: 1005992832

View in Genome Browser
Species Human (GRCh38)
Location 6:30914180-30914202
Sequence TGGCCCCACCCTCTCCCTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 461}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005992832_1005992837 7 Left 1005992832 6:30914180-30914202 CCGGTAGGGAGAGGGTGGGGCCA 0: 1
1: 0
2: 2
3: 35
4: 461
Right 1005992837 6:30914210-30914232 CTGCTGCGCATGCGCCGGCCGGG 0: 1
1: 0
2: 6
3: 14
4: 99
1005992832_1005992834 2 Left 1005992832 6:30914180-30914202 CCGGTAGGGAGAGGGTGGGGCCA 0: 1
1: 0
2: 2
3: 35
4: 461
Right 1005992834 6:30914205-30914227 GCCAGCTGCTGCGCATGCGCCGG 0: 1
1: 0
2: 1
3: 20
4: 160
1005992832_1005992838 8 Left 1005992832 6:30914180-30914202 CCGGTAGGGAGAGGGTGGGGCCA 0: 1
1: 0
2: 2
3: 35
4: 461
Right 1005992838 6:30914211-30914233 TGCTGCGCATGCGCCGGCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1005992832_1005992836 6 Left 1005992832 6:30914180-30914202 CCGGTAGGGAGAGGGTGGGGCCA 0: 1
1: 0
2: 2
3: 35
4: 461
Right 1005992836 6:30914209-30914231 GCTGCTGCGCATGCGCCGGCCGG 0: 1
1: 0
2: 1
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005992832 Original CRISPR TGGCCCCACCCTCTCCCTAC CGG (reversed) Intronic