ID: 1005992834

View in Genome Browser
Species Human (GRCh38)
Location 6:30914205-30914227
Sequence GCCAGCTGCTGCGCATGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005992832_1005992834 2 Left 1005992832 6:30914180-30914202 CCGGTAGGGAGAGGGTGGGGCCA 0: 1
1: 0
2: 2
3: 35
4: 461
Right 1005992834 6:30914205-30914227 GCCAGCTGCTGCGCATGCGCCGG 0: 1
1: 0
2: 1
3: 20
4: 160
1005992827_1005992834 10 Left 1005992827 6:30914172-30914194 CCTTTGGACCGGTAGGGAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1005992834 6:30914205-30914227 GCCAGCTGCTGCGCATGCGCCGG 0: 1
1: 0
2: 1
3: 20
4: 160
1005992822_1005992834 24 Left 1005992822 6:30914158-30914180 CCTCTGGTCTACAGCCTTTGGAC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1005992834 6:30914205-30914227 GCCAGCTGCTGCGCATGCGCCGG 0: 1
1: 0
2: 1
3: 20
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005992834 Original CRISPR GCCAGCTGCTGCGCATGCGC CGG Intronic