ID: 1005994672

View in Genome Browser
Species Human (GRCh38)
Location 6:30923955-30923977
Sequence CTCCTTTAGCAGGTTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 283}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005994657_1005994672 5 Left 1005994657 6:30923927-30923949 CCCCCGCTCCACTGCCACCCCAG 0: 2
1: 0
2: 10
3: 64
4: 674
Right 1005994672 6:30923955-30923977 CTCCTTTAGCAGGTTGGGGTGGG 0: 1
1: 0
2: 1
3: 30
4: 283
1005994658_1005994672 4 Left 1005994658 6:30923928-30923950 CCCCGCTCCACTGCCACCCCAGA 0: 1
1: 0
2: 2
3: 51
4: 499
Right 1005994672 6:30923955-30923977 CTCCTTTAGCAGGTTGGGGTGGG 0: 1
1: 0
2: 1
3: 30
4: 283
1005994663_1005994672 -9 Left 1005994663 6:30923941-30923963 CCACCCCAGAGTGGCTCCTTTAG 0: 1
1: 0
2: 0
3: 20
4: 179
Right 1005994672 6:30923955-30923977 CTCCTTTAGCAGGTTGGGGTGGG 0: 1
1: 0
2: 1
3: 30
4: 283
1005994662_1005994672 -3 Left 1005994662 6:30923935-30923957 CCACTGCCACCCCAGAGTGGCTC 0: 1
1: 0
2: 3
3: 26
4: 364
Right 1005994672 6:30923955-30923977 CTCCTTTAGCAGGTTGGGGTGGG 0: 1
1: 0
2: 1
3: 30
4: 283
1005994655_1005994672 7 Left 1005994655 6:30923925-30923947 CCCCCCCGCTCCACTGCCACCCC 0: 1
1: 0
2: 6
3: 130
4: 1263
Right 1005994672 6:30923955-30923977 CTCCTTTAGCAGGTTGGGGTGGG 0: 1
1: 0
2: 1
3: 30
4: 283
1005994660_1005994672 2 Left 1005994660 6:30923930-30923952 CCGCTCCACTGCCACCCCAGAGT 0: 1
1: 1
2: 2
3: 51
4: 417
Right 1005994672 6:30923955-30923977 CTCCTTTAGCAGGTTGGGGTGGG 0: 1
1: 0
2: 1
3: 30
4: 283
1005994656_1005994672 6 Left 1005994656 6:30923926-30923948 CCCCCCGCTCCACTGCCACCCCA 0: 1
1: 0
2: 7
3: 75
4: 813
Right 1005994672 6:30923955-30923977 CTCCTTTAGCAGGTTGGGGTGGG 0: 1
1: 0
2: 1
3: 30
4: 283
1005994659_1005994672 3 Left 1005994659 6:30923929-30923951 CCCGCTCCACTGCCACCCCAGAG 0: 1
1: 0
2: 5
3: 55
4: 576
Right 1005994672 6:30923955-30923977 CTCCTTTAGCAGGTTGGGGTGGG 0: 1
1: 0
2: 1
3: 30
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005994672 Original CRISPR CTCCTTTAGCAGGTTGGGGT GGG Intronic
901916941 1:12507179-12507201 CTCATTTAGGAGGTTGAGGCTGG + Intronic
902260951 1:15224425-15224447 TTCCTTAAGCAAGTTGGAGTGGG + Intergenic
902634993 1:17729193-17729215 CTCCTTGAGCAGGTGGGGGAAGG + Intergenic
903523288 1:23972160-23972182 CTACTTTGGGAGGTTGAGGTGGG + Intronic
904994545 1:34621077-34621099 CTCCTTCAGGAGTTGGGGGTAGG - Intergenic
905978551 1:42200723-42200745 CTCCTTTGGGAGGCTGAGGTGGG - Intronic
906362476 1:45175559-45175581 CTACTTTAGGAGGCTGAGGTGGG - Intronic
907313313 1:53552236-53552258 CACCTATAGCAGCTTAGGGTTGG - Intronic
908286099 1:62604624-62604646 CTCCTTTAGGAGGCTGGTGGTGG + Exonic
910247008 1:85149586-85149608 CTCCTATAGCAGGGTTGGGGAGG - Intergenic
910753431 1:90659481-90659503 CTACTTTGGGAGGTTGTGGTGGG - Intergenic
910796030 1:91098812-91098834 CTTCTTTAGCAGGTCTGAGTGGG - Intergenic
912111757 1:106350845-106350867 CTCATTGAGAAGGGTGGGGTGGG + Intergenic
913958998 1:143324742-143324764 CACCTTTCGCAGTGTGGGGTGGG - Intergenic
914053315 1:144150122-144150144 CACCTTTCGCAGTGTGGGGTGGG - Intergenic
914125882 1:144816419-144816441 CACCTTTCGCAGTGTGGGGTGGG + Intergenic
914218730 1:145658146-145658168 CTCATTTAGCATAATGGGGTTGG + Intronic
914471312 1:147981010-147981032 CTCATTTAGCATAATGGGGTTGG + Intronic
914807435 1:151001864-151001886 CTCCAGTAGTAGGGTGGGGTAGG + Intronic
915256176 1:154631202-154631224 CTCCTTTATCAGGTTAAGGAAGG + Intergenic
916451200 1:164922130-164922152 CTGATTTAGCAATTTGGGGTGGG + Intergenic
916504059 1:165411705-165411727 CTCATTTTGGAGGTTGGGGAGGG + Intronic
917120372 1:171640255-171640277 TTCCTATAGGAGTTTGGGGTGGG + Intronic
919750368 1:201034142-201034164 CTCCTCTAGCAGTCTGGGGCAGG + Intergenic
919970534 1:202574397-202574419 CTACTTTAGGAGGCTGAGGTGGG + Intronic
920005044 1:202826961-202826983 CTCCCTTAGGAGGCTGAGGTGGG + Exonic
920153938 1:203933101-203933123 CTACTTTAGGAGGCTGGGGTGGG + Intergenic
922676935 1:227559109-227559131 CCCTTTGAGCAGGCTGGGGTAGG - Intergenic
924782931 1:247169546-247169568 TTCCCTGAGCAGGATGGGGTGGG - Intronic
1063169541 10:3495215-3495237 CTCCTTTAGGAGGTGGAGGCAGG - Intergenic
1063649142 10:7915730-7915752 CACCTTTGGGAGGTTGAGGTGGG + Intronic
1064370957 10:14751199-14751221 CTCCTTGGGGAGGCTGGGGTGGG - Intronic
1064576429 10:16750757-16750779 CTGATTTAGTAGGTTGGGGAGGG + Intronic
1066758699 10:38735878-38735900 CACCTTTCGCAGTGTGGGGTGGG + Intergenic
1069038346 10:63669227-63669249 CTCCTTAAACAGGCTGGGCTGGG - Intergenic
1069804372 10:71108893-71108915 CCACTTTGGCAGGTTGAGGTGGG - Intergenic
1070062982 10:73004032-73004054 CTACTTGAGCAGGCTGAGGTGGG - Intergenic
1070089255 10:73268803-73268825 CTACTTTCGAGGGTTGGGGTGGG - Intronic
1070279305 10:75037245-75037267 CTCCTCCAGCAGGGTGGGGAGGG - Intergenic
1070629322 10:78073522-78073544 CTCCTCAAGGAAGTTGGGGTAGG + Intergenic
1074106890 10:110395359-110395381 CTGGTTCAGCAGGTTGGGGTAGG + Intergenic
1075365795 10:121887461-121887483 GTACTTTAGCAGGTTGAGGCAGG + Intronic
1075787469 10:125059779-125059801 CTCCTGGAGCTGGTGGGGGTGGG - Intronic
1075817361 10:125275175-125275197 CTGCTTTAGCAGATTTGGGAAGG + Intergenic
1077409058 11:2395100-2395122 CTCCTGTCGCGGGTGGGGGTTGG + Intronic
1077837206 11:5935707-5935729 CTCCCTTAACAGGGTGAGGTAGG - Intronic
1078096294 11:8299318-8299340 CTCTTTGAGCGGGGTGGGGTCGG - Intergenic
1078772411 11:14363407-14363429 CTCATTTAGCAGGTCTGGGGAGG - Intronic
1079185908 11:18236312-18236334 ATCCTTTGGGAGGTTGAGGTAGG - Intronic
1079574253 11:21983645-21983667 TTCCTCAAGCAGTTTGGGGTAGG - Intergenic
1081069594 11:38595003-38595025 TGCCTTTATCAGGTGGGGGTTGG - Intergenic
1081613568 11:44577815-44577837 CTACTCAAGCGGGTTGGGGTAGG - Intronic
1083726587 11:64631538-64631560 CTTCTTCAGCGGGTTGGTGTAGG - Intronic
1084273387 11:68040398-68040420 CTCCTTTCCCAGGCTGGGGCTGG + Intronic
1085586690 11:77714875-77714897 CTGCTTTAGAAGGTTGAGGTGGG + Intronic
1087569559 11:99907384-99907406 CACCGTCAGGAGGTTGGGGTGGG + Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089489170 11:118871066-118871088 CTCTTTTTTGAGGTTGGGGTGGG - Intergenic
1089679734 11:120112541-120112563 CTCCTGAGGCAGGTTAGGGTAGG - Intronic
1090306801 11:125698237-125698259 CCTCTTTAGCAGGGTGTGGTGGG + Intergenic
1091640878 12:2236230-2236252 CTGATTCAGCAGGTTCGGGTTGG + Intronic
1092107193 12:5930326-5930348 ATTCTTTGGGAGGTTGGGGTGGG - Intronic
1092107372 12:5931312-5931334 ATTCTTTGGGAGGTTGGGGTGGG + Intronic
1093832399 12:23778657-23778679 CTCCTTTAACAGGAAGGGCTGGG + Intronic
1095665186 12:44788987-44789009 CTCCTTGGGCAGGTTGCTGTGGG - Intronic
1096651737 12:53065222-53065244 GTGCCTGAGCAGGTTGGGGTGGG + Exonic
1096830438 12:54309735-54309757 CTACTTTGGGAGGCTGGGGTGGG - Intronic
1097160125 12:57040187-57040209 TTCCTTTAACTGGTTGGGGAAGG - Intronic
1097266750 12:57750317-57750339 CTACTTTGGGAGGTAGGGGTGGG + Intronic
1097865507 12:64556484-64556506 CTCCTTTAACAGGCAGGGGCAGG - Intergenic
1097888069 12:64749986-64750008 CTACTTTGGGAAGTTGGGGTGGG - Intronic
1098528232 12:71511369-71511391 CTGATTTACCAGGTTGGGGTGGG - Intronic
1099217449 12:79870392-79870414 CTCTTTTAGCAGGTTGGGCATGG - Intronic
1100167111 12:91928635-91928657 CCCCTTCATCAGCTTGGGGTAGG - Intergenic
1101429647 12:104616438-104616460 TCCCTTTGGCAGGCTGGGGTGGG - Intronic
1103319541 12:120083544-120083566 CTCCTTGAACAGGGTGGGGCTGG - Intronic
1104599969 12:130146132-130146154 AGCCTTTGGGAGGTTGGGGTGGG + Intergenic
1106173218 13:27307119-27307141 GTGCTTTAGAATGTTGGGGTTGG - Intergenic
1107285283 13:38783435-38783457 CTACTTGAGCAGGCTGGGTTGGG - Intronic
1107914650 13:45137111-45137133 CTCCTTGAGCAGGTTTGCTTAGG + Intronic
1109314548 13:60734767-60734789 GTCCTTTAGAAGGTTGTGGCAGG - Intergenic
1110171439 13:72505624-72505646 CTCCTTTGGGAGGCTGAGGTGGG + Intergenic
1111910062 13:94301242-94301264 ATCCATTAGCAGGGTGTGGTTGG + Intronic
1113776800 13:112952431-112952453 CTCCTTTAGAAGGAGGTGGTTGG - Intronic
1117199221 14:53371259-53371281 CACCTTTAGCTGGATGGAGTGGG + Intergenic
1117343013 14:54807813-54807835 CTCCTTTAGCTGCTGGGGGTTGG - Intergenic
1118992023 14:70805813-70805835 CTTCTTTGGGAGGCTGGGGTGGG + Intronic
1119408391 14:74412650-74412672 CCCCTTGAGCAGGTTGAGGAAGG + Intronic
1119737844 14:76995364-76995386 TTCATTCAGCAGGTTGGGGGTGG + Intergenic
1119898016 14:78237292-78237314 TTCCTTTAGCAAGTTTGAGTTGG - Intergenic
1119910041 14:78341296-78341318 CTGGTTTAGAAGTTTGGGGTAGG + Intronic
1119954123 14:78776892-78776914 CTGATTCAGTAGGTTGGGGTAGG + Intronic
1120259160 14:82160392-82160414 CCCCTTTTGCAGGTTCTGGTTGG + Intergenic
1120417186 14:84234334-84234356 GCCCTTTAGGAGGCTGGGGTGGG - Intergenic
1121596076 14:95163720-95163742 CTCCTTAAGGAGTTTGGGGTAGG - Intergenic
1121603127 14:95220811-95220833 CTCCTTCTGCAGGCTGTGGTGGG + Intronic
1121720777 14:96107217-96107239 CTTAGTTAGCAGGGTGGGGTGGG - Intergenic
1122772697 14:104104374-104104396 CTCCTGCAGCAGGTCGGGCTTGG - Exonic
1123055048 14:105565707-105565729 CTCCTCTAGGAGGCTGGGGTGGG + Intergenic
1123079496 14:105685551-105685573 CTCCTCTAGGAGGCTGGGGTGGG + Intergenic
1202929409 14_KI270725v1_random:25448-25470 CACCTTTCGCAGTGTGGGGTGGG + Intergenic
1123422883 15:20145774-20145796 CACCTTTCGCAGTGTGGGGTGGG - Intergenic
1123442122 15:20300576-20300598 CACCTTTCGCAGTGTGGGGTGGG + Intergenic
1123532109 15:21152314-21152336 CACCTTTCGCAGTGTGGGGTGGG - Intergenic
1123948417 15:25250032-25250054 CTCCTTGAGCCTGTTGGGGGTGG + Intergenic
1124145091 15:27117466-27117488 CTCCTATACCATTTTGGGGTAGG + Intronic
1124907675 15:33886547-33886569 CTCCTTTGGGAGGCTGAGGTGGG - Intronic
1126684482 15:51235341-51235363 CTCATTTAGTAGGTCAGGGTGGG + Intronic
1127473717 15:59313008-59313030 CTCATTTAGCAGGTTTAGGGTGG - Intronic
1128235656 15:66065574-66065596 GTCCTTGGGCAGGTGGGGGTGGG + Intronic
1128387889 15:67163607-67163629 CTGATTTAGTAGGTTGGGGTAGG + Intronic
1128715435 15:69904432-69904454 CTGCTTTCGGAGGTTAGGGTGGG + Intergenic
1128735439 15:70051234-70051256 CTCCCCTATCAGGTAGGGGTGGG + Intronic
1128984250 15:72207719-72207741 TGCCTTCAGCAGGTTGGAGTGGG - Intronic
1129741720 15:77992723-77992745 CTCCTTAAGGTGGTTGGGGTGGG + Intronic
1129836591 15:78711646-78711668 CCCCTTTAGGAGGCTGAGGTGGG + Intronic
1129843923 15:78759640-78759662 CTCCTTAAGGTGGTTGGCGTAGG - Intronic
1130257885 15:82334160-82334182 CTCCTTGAGGTGGTTGGGGTGGG + Intergenic
1130597048 15:85255803-85255825 CTCCTTAAGGTGGTTGGGGTGGG - Intergenic
1132253677 15:100354872-100354894 GTCCTTTATCAGGTTGAGGAAGG - Intergenic
1133193313 16:4150577-4150599 CTCCTTTGGGAGGTTGAGGCAGG - Intergenic
1134479224 16:14603169-14603191 CTACTTTAGGAGGCTGAGGTGGG - Intronic
1135152705 16:20023159-20023181 CTGGTTCAGCAGGCTGGGGTGGG + Intergenic
1136719094 16:32304975-32304997 CACCTTTTGCAGTGTGGGGTGGG - Intergenic
1136837465 16:33511239-33511261 CACCTTTTGCAGTGTGGGGTGGG - Intergenic
1136861863 16:33709566-33709588 CACCTTTCGCAGTGTGGGGTGGG + Intergenic
1136931400 16:34421118-34421140 GCACTTTAGCAGGTTGAGGTAGG + Intergenic
1136973173 16:34990701-34990723 GCACTTTAGCAGGTTGAGGTAGG - Intergenic
1138653500 16:58475482-58475504 TTCCTTTAGCACGATAGGGTGGG + Intronic
1139024961 16:62805262-62805284 CTAATCTAGCAGGTTGGGCTGGG + Intergenic
1139383325 16:66548408-66548430 GTGCTTTAGCTGGCTGGGGTAGG - Intronic
1139536375 16:67577304-67577326 CTACTTGAGGAGGTTGAGGTGGG + Intronic
1140880252 16:79191705-79191727 CACATTTGCCAGGTTGGGGTAGG - Intronic
1141664458 16:85458694-85458716 CTCATTTAGCAGGTCTGGGGCGG - Intergenic
1203007337 16_KI270728v1_random:212796-212818 CACCTTTTGCAGTGTGGGGTGGG + Intergenic
1203123358 16_KI270728v1_random:1557749-1557771 CACCTTTCGCAGTGTGGGGTGGG + Intergenic
1203147647 16_KI270728v1_random:1811518-1811540 CACCTTTCGCAGTGTGGGGTGGG - Intergenic
1142899945 17:3005548-3005570 CTCCTTTTGCAGGTTTTGGGGGG + Intronic
1142952707 17:3496702-3496724 CTACTTTAGTAGTTTGTGGTGGG - Intronic
1143059075 17:4184951-4184973 CTCCGTCTGCAGGTTTGGGTTGG + Exonic
1143115728 17:4581001-4581023 CTCCTTTGGGAGGCTGAGGTGGG - Intergenic
1143679357 17:8464918-8464940 CTCCTCAAGCAGGTTGAGGATGG - Intronic
1143736621 17:8915964-8915986 TCCCTTGAGCAGGGTGGGGTTGG - Intronic
1144514315 17:15905624-15905646 CTCATTTAGGAGGCTGAGGTGGG - Intergenic
1146631071 17:34469701-34469723 CTCCTTTGGAAGGTGAGGGTAGG + Intergenic
1146673452 17:34757379-34757401 CTCCTATAGCAGGGTGTGCTGGG + Intergenic
1146704433 17:34990524-34990546 GCACTTTAGCAGGTTGAGGTAGG - Intronic
1147012809 17:37465034-37465056 CTACTTTGGGAGGTTGAGGTAGG + Intronic
1147674266 17:42193880-42193902 CTCTTTCAGAAGGTAGGGGTGGG + Exonic
1148846073 17:50530776-50530798 CCCATTTAGCCGTTTGGGGTGGG - Intronic
1149190387 17:54054423-54054445 TTCCTTTATCAGGTTGAGGGAGG + Intergenic
1150605461 17:66686793-66686815 CTGCTTTGGCAGGTTTGGGGTGG + Intronic
1152027075 17:77817144-77817166 CTACTTTGGGAGGCTGGGGTGGG - Intergenic
1152761071 17:82107296-82107318 CACCTGCAGCAGGTTGGGGGTGG + Intronic
1203183810 17_KI270729v1_random:92683-92705 GTACTTTGGGAGGTTGGGGTTGG - Intergenic
1153930287 18:9872509-9872531 CTTCTTTAGAAGGTGGGCGTTGG + Intergenic
1155508404 18:26552085-26552107 CACCTTTTGCTGGTGGGGGTGGG + Intronic
1157279387 18:46335633-46335655 CTCCTCTACCAAGTCGGGGTGGG + Intronic
1158501989 18:58010720-58010742 CTCCTTCAGGGGTTTGGGGTAGG - Intergenic
1160711390 19:552903-552925 ATCCTTTAGGAGGCTGAGGTGGG - Intergenic
1162344670 19:10112306-10112328 CTCCTTAAGCAGGCTGGCGTTGG + Intronic
1163321918 19:16579704-16579726 CTCCTTTATCATGTTGGGGTGGG - Intronic
1163372119 19:16907112-16907134 CTCCTCCTGCAGGGTGGGGTGGG + Exonic
1165079782 19:33300698-33300720 AGCCTATAGCAGGCTGGGGTGGG + Exonic
1165719584 19:38069599-38069621 CTGAATTAGCTGGTTGGGGTGGG - Intronic
1167982405 19:53286087-53286109 CTGATTGAGCAGGTGGGGGTGGG - Intergenic
1167983745 19:53297944-53297966 CTGATTGAGCAGGTGGGGGTGGG + Intergenic
1168000322 19:53440592-53440614 CCCTTTTTGCAGGATGGGGTAGG + Intronic
1168347583 19:55658577-55658599 CTCCTTCAGCAGGTCAGGGGAGG - Intronic
1202692713 1_KI270712v1_random:102545-102567 CACCTTTCGCAGTGTGGGGTGGG - Intergenic
925583294 2:5436502-5436524 ATCCTTTAGCAGGTAGAGATGGG + Intergenic
926285917 2:11488017-11488039 CTCCTTGAGGAGGTTGGCTTGGG + Intergenic
927188097 2:20497036-20497058 CTCCATTTGCCGGGTGGGGTAGG + Intergenic
927870203 2:26618544-26618566 CTACTTTAGGAGGTCGAGGTGGG - Intronic
928179385 2:29057249-29057271 CTGCTTCAGCAGGTCTGGGTGGG + Exonic
932249629 2:70231349-70231371 CTACTTTAGGAGGCTGAGGTGGG + Intronic
933333581 2:80925854-80925876 CTCCTTCAGTAGGTGGTGGTAGG + Intergenic
933559969 2:83876636-83876658 CTCCCTTAACAGGGTGAGGTAGG + Intergenic
933953689 2:87351419-87351441 CACCTTTCGCAGTGTGGGGTGGG + Intergenic
934275308 2:91569064-91569086 CACCTTTTGCAGTGTGGGGTGGG - Intergenic
934322020 2:91980223-91980245 CACCTTTCGCAGTGTGGGGTGGG + Intergenic
935443951 2:103136999-103137021 CTACTTCAGCAGGATGGGGATGG + Intergenic
937320284 2:120956773-120956795 AGCCTGTAGCAGGTTGGGGTGGG + Intronic
942494647 2:176526965-176526987 CTCCTTTCTCAGGTTAGGGCTGG + Intergenic
942671336 2:178379058-178379080 CTCCTTCAGGAGGCTGAGGTGGG + Intronic
943734396 2:191338644-191338666 CTGCTTTAGCAGGGTGGTGGTGG - Intronic
947529733 2:230901189-230901211 CTCCCTTGGCAGGATGGGGCTGG - Intergenic
947770739 2:232668306-232668328 CTTCTTTAACTGGCTGGGGTAGG + Intronic
1168763521 20:366050-366072 CTCCTTTGGGAGGCTGAGGTGGG - Intronic
1169332863 20:4730257-4730279 CTGCTTCAGCAGGTTTGGGGTGG + Intergenic
1170534747 20:17329026-17329048 CTCCATTAGCAGGTTGGGAATGG + Intronic
1170671732 20:18440557-18440579 CTCCTGTAGCATGCTGGGTTGGG + Intronic
1170759120 20:19234257-19234279 CCCATTCAGCAGGTTGGGGAGGG - Intronic
1175658366 20:60791650-60791672 CTCCTTTAGCAGGTGGAGCTGGG + Intergenic
1176243793 20:64087835-64087857 CACCCTTGGCAGGTTGGGGGAGG + Intronic
1176591432 21:8654047-8654069 CACCTTTCGCAGTGTGGGGTGGG + Intergenic
1178888976 21:36505371-36505393 CTCCTCCAGCAGCTTGGGGTGGG - Intronic
1179988575 21:44934025-44934047 CTCCTTCAGCAGGTCTGGGTGGG + Intronic
1180274280 22:10631158-10631180 CACCTTTCGCAGTTTGGGGTGGG + Intergenic
1181355944 22:22295747-22295769 CACCTTTCGCAGTGTGGGGTGGG - Intergenic
1182274912 22:29181907-29181929 CTACTTTGGGAGGCTGGGGTGGG + Intergenic
1183331619 22:37225291-37225313 CTGCTTAAGCAGGTTGAGTTGGG + Exonic
1183432598 22:37774736-37774758 CTGGTTCAGTAGGTTGGGGTGGG - Exonic
1183601923 22:38844662-38844684 CTCCTTCAGAAGGTTGGAGGTGG - Intergenic
1184439821 22:44502718-44502740 CCCATCTAGCAGTTTGGGGTGGG - Intergenic
1184572506 22:45334941-45334963 CTCCCTTTCCAGGTTGGGGCAGG + Intronic
1184610910 22:45602459-45602481 CTTCTTCAGTAGGGTGGGGTGGG + Intergenic
949928997 3:9063837-9063859 GTCCTTTAGTAGGGTGTGGTGGG - Intronic
951944140 3:28115040-28115062 ATCCTTTAGCAGGCTGGGCTAGG + Intergenic
953465749 3:43117934-43117956 CTCCTTAAGCATCTTGGGTTGGG - Intergenic
953768590 3:45762129-45762151 CTGATTCAGCAGGATGGGGTGGG + Intronic
953795336 3:45981020-45981042 CTGATTCAGTAGGTTGGGGTGGG + Intronic
953879749 3:46685514-46685536 GTCCTGCTGCAGGTTGGGGTGGG - Exonic
955405806 3:58624976-58624998 CTTCTGTGGGAGGTTGGGGTGGG + Intronic
955697271 3:61649264-61649286 GTACTTTAGCAGGCTGAGGTGGG - Intronic
956128666 3:66035133-66035155 GTCCTTTGTCAGGTTGGAGTTGG - Intronic
957429967 3:80091577-80091599 CTACTTTGGCAGGCTGAGGTGGG - Intergenic
959025238 3:101233364-101233386 CAACTGCAGCAGGTTGGGGTTGG - Intronic
960097068 3:113699056-113699078 CTCCTGGAGCAGGATGGGGGTGG - Intergenic
961568302 3:127779729-127779751 CTTCTTTAGAAGGTTGGGGAGGG - Intronic
961998443 3:131270383-131270405 CTTCTTTAGTAGGTTTGGGTAGG - Intronic
962936659 3:140087736-140087758 CTCCTCTCTCAGGTTGGGTTAGG - Intronic
964188034 3:153970160-153970182 CTGATTCAGTAGGTTGGGGTTGG + Intergenic
964229404 3:154446231-154446253 TTCCTTTAGGAATTTGGGGTTGG - Intergenic
965168466 3:165227994-165228016 CTTCTTTATCTGGTTGGGGATGG + Intergenic
967460288 3:189738431-189738453 CTCATTTAACAAGTGGGGGTTGG + Intronic
968577381 4:1374236-1374258 CTCCTGCAGCAGGTTTGGGGAGG + Intronic
968621242 4:1604339-1604361 CTGCCTACGCAGGTTGGGGTGGG + Intergenic
970545169 4:17122002-17122024 CTCCTTCAGAAGGCTGGGGTTGG - Intergenic
971501997 4:27328052-27328074 CTCCTGTAACAGGGTGGGGGTGG - Intergenic
971617037 4:28804270-28804292 ATCCTTTGGGAGGCTGGGGTAGG + Intergenic
975404833 4:73977114-73977136 CTCCTTTCCCAGGTTAGGCTAGG - Intergenic
975837822 4:78442800-78442822 CTGTTTTAGGAGGTTGGTGTGGG + Intronic
981469538 4:145115221-145115243 CTCCATTTGAAGGTTGGGGTTGG + Intronic
987052567 5:14160196-14160218 CACGTAGAGCAGGTTGGGGTTGG + Intronic
988796594 5:34657282-34657304 CTTCTTGGGCAGGTTGGTGTCGG + Intronic
989359521 5:40584801-40584823 CTGATTTAGTAGGTTTGGGTTGG - Intergenic
989595510 5:43152716-43152738 CTCCTTTGGGAGGCTGAGGTGGG - Intronic
993832594 5:92778211-92778233 CTTATTTAGCAGGTTTGGGGGGG - Intergenic
994231713 5:97315587-97315609 CTCCTTTAGCTGCTTGAGGAAGG + Intergenic
999128201 5:149262442-149262464 CTGATTGGGCAGGTTGGGGTGGG - Intergenic
999977238 5:156923947-156923969 CTACTTTGGGAGGCTGGGGTGGG - Intronic
1000226923 5:159271347-159271369 CTACTTTAGGAGGCTGAGGTGGG + Intronic
1000477766 5:161732596-161732618 CTCCTTTTGCAGGGCGGAGTGGG + Intergenic
1001808749 5:174610784-174610806 CTGATTTAGCAGATTTGGGTTGG - Intergenic
1001854011 5:174995096-174995118 CTGCTTGAGCATCTTGGGGTGGG + Intergenic
1002270926 5:178071372-178071394 CTTCTATAGCAGGTTGGTGGTGG - Intergenic
1003214772 6:4099328-4099350 CTCCTCTAGCAGCTTGGTGGTGG - Intronic
1003237671 6:4311843-4311865 ATCTTTTAGCAGGTTGATGTAGG + Intergenic
1004721865 6:18274747-18274769 CTGCTTTAGGAGGCTGAGGTGGG - Intergenic
1005408712 6:25519804-25519826 TTCCTTTACCAGTTTGGGGCTGG + Intronic
1005994672 6:30923955-30923977 CTCCTTTAGCAGGTTGGGGTGGG + Intronic
1006205519 6:32338249-32338271 CTGATTTAGTAGGTCGGGGTGGG + Intronic
1006256576 6:32837526-32837548 CTCCTTTGGCAGGTAGGTGGTGG - Exonic
1007442113 6:41871097-41871119 CTGCTTTGGGAGGTTGAGGTGGG - Intronic
1009469206 6:64010710-64010732 CTCATTCAGCAGGTAGGGTTGGG - Intronic
1010682511 6:78812964-78812986 CTCTTTTAGCAGGTTGGTGGTGG - Intergenic
1011783182 6:90813442-90813464 GGCCTGTAGGAGGTTGGGGTTGG - Intergenic
1012910464 6:105112120-105112142 CTGATGTAGCAGGCTGGGGTGGG - Intronic
1015166066 6:130201447-130201469 CTGATTTAGTAGGTTAGGGTGGG - Intronic
1015864770 6:137716979-137717001 CTGATTTAGGAGGTTGGAGTGGG + Intergenic
1018078153 6:160234459-160234481 CTCCTGTGGCAGGGTGGGGAAGG - Intronic
1019699783 7:2469031-2469053 CTCCTTTACCAGCATGGGGCAGG - Intergenic
1019985134 7:4650152-4650174 ATGCTTTAGAAGGTTGAGGTGGG - Intergenic
1020038986 7:4986990-4987012 GTGCTTTAGGAGGTTGAGGTGGG - Intronic
1021348120 7:19553082-19553104 CACCTTAAGCAGGTTGGAGAAGG + Intergenic
1021903541 7:25311232-25311254 CTCTTTGAGCAGGTTTGGTTGGG + Intergenic
1023975646 7:45027927-45027949 CTGCTTTGGGAGGATGGGGTGGG + Intronic
1024713200 7:52041528-52041550 ATCCTTTGGGAGGTTGAGGTAGG + Intergenic
1025614619 7:63106992-63107014 CTCCTTCAGCTGCTGGGGGTTGG + Intergenic
1025806320 7:64837422-64837444 CTCCCTTAACAGGGTGAGGTAGG + Intergenic
1025947202 7:66113806-66113828 CTACTCTGGCAGGCTGGGGTGGG + Intronic
1028045107 7:86108033-86108055 CTACTTTTGCAGGCTGGAGTGGG - Intergenic
1034348230 7:150399833-150399855 CTGCTTTAACAGGGTGGGGGAGG + Intronic
1034733846 7:153411414-153411436 CTCCCTTAACAGGGTGAGGTAGG + Intergenic
1035356149 7:158276984-158277006 CCCCTCTAACAGGGTGGGGTGGG + Intronic
1036549457 8:9803866-9803888 CTCCTTTGGGAGGCTGAGGTGGG - Intergenic
1037269491 8:17110821-17110843 CTACTTTGGGAGGTTGAGGTGGG - Intronic
1037687931 8:21159345-21159367 CCCCTTTCCCAGGTTGGGGAGGG + Intergenic
1038435884 8:27535736-27535758 CTCCTGGAGAGGGTTGGGGTAGG + Intronic
1040524423 8:48207025-48207047 TTCCTTTAGCATTTTGGGCTCGG - Intergenic
1040611167 8:48983499-48983521 CTCCTTTGGGAGGCTGAGGTTGG - Intergenic
1041074057 8:54152696-54152718 CTACTTTGGGAGGTTGAGGTGGG + Intergenic
1042294111 8:67201568-67201590 CTGCTTCAGAAGGTTGGGCTTGG + Exonic
1044112406 8:88291032-88291054 CTACTTTGGAAGGCTGGGGTAGG + Intronic
1045521122 8:102904306-102904328 TACCTTTTGCAGGTTGGGGTGGG - Intronic
1046406834 8:113784719-113784741 CTAATTTAGCAATTTGGGGTGGG - Intergenic
1051390374 9:16557107-16557129 CTCATTTATCAGGATGGAGTGGG + Intronic
1053690804 9:40586706-40586728 CACCTTTCGCAGTGTGGGGTGGG + Intergenic
1054274000 9:63050785-63050807 CACCTTTCGCAGTGTGGGGTGGG - Intergenic
1054302062 9:63387677-63387699 CACCTTTCGCAGTGTGGGGTGGG + Intergenic
1054400840 9:64714183-64714205 CACCTTTCGCAGTGTGGGGTGGG + Intergenic
1054434447 9:65198497-65198519 CACCTTTCGCAGTGTGGGGTGGG + Intergenic
1054495943 9:65823184-65823206 CACCTTTCGCAGTGTGGGGTGGG - Intergenic
1056297017 9:85203222-85203244 CTGATTTAGCAGGTCTGGGTGGG + Intergenic
1056753436 9:89367895-89367917 CTCCGTTAGAGGCTTGGGGTGGG - Intronic
1056975856 9:91252593-91252615 CTACTCTAGCTGGGTGGGGTTGG - Intronic
1057921756 9:99104279-99104301 CTCCTTTGAGGGGTTGGGGTGGG + Intronic
1058529285 9:105889807-105889829 TTTCTTTAGCAGGTTAGGTTTGG - Intergenic
1059542900 9:115147898-115147920 CTAATTTCCCAGGTTGGGGTAGG - Intronic
1060795589 9:126510656-126510678 ATCCATTTGCAGGTTGGGGAGGG + Intergenic
1061035048 9:128108771-128108793 TTCCTTTGGCAGGTTGGGGAAGG + Exonic
1203621459 Un_KI270749v1:132811-132833 CACCTTTCGCAGTGTGGGGTGGG + Intergenic
1188269545 X:28121700-28121722 GACATTTAGCTGGTTGGGGTTGG - Intergenic
1189346703 X:40247430-40247452 TCCCTCTAGCAGGTGGGGGTGGG - Intergenic
1189470790 X:41312491-41312513 CCCACTAAGCAGGTTGGGGTGGG - Intergenic
1190006395 X:46743538-46743560 CTCCCTTAGGAGGTTGGGGGTGG - Intronic
1190703847 X:53008748-53008770 GTGCTTTAGGAGGTTGAGGTGGG - Intergenic
1193213782 X:78839046-78839068 TTCCTTTAGCAGGTTCAGGAGGG - Intergenic
1195388081 X:104332538-104332560 ATCCTTTAGAAGGTTTAGGTGGG + Intergenic
1198547218 X:137705114-137705136 CTGATTCAGTAGGTTGGGGTCGG + Intergenic
1199053930 X:143270145-143270167 CTGATTCAGCAGGTTGGGGACGG - Intergenic
1199914170 X:152320907-152320929 AGCCTTTATCAGGTTGGAGTTGG - Intronic
1200161684 X:154012954-154012976 CTCTTCTAGAAGGCTGGGGTGGG + Intronic
1202584137 Y:26406571-26406593 CACCTTTCGCAGTGTGGGGTGGG - Intergenic