ID: 1005995619

View in Genome Browser
Species Human (GRCh38)
Location 6:30929466-30929488
Sequence TTTCATATGGAGATAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005995612_1005995619 26 Left 1005995612 6:30929417-30929439 CCATACTGAACTCTTGTTGTCTT No data
Right 1005995619 6:30929466-30929488 TTTCATATGGAGATAATGGAGGG No data
1005995614_1005995619 -3 Left 1005995614 6:30929446-30929468 CCAAAGGAGTCAGTCTCCAATTT No data
Right 1005995619 6:30929466-30929488 TTTCATATGGAGATAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005995619 Original CRISPR TTTCATATGGAGATAATGGA GGG Intergenic
No off target data available for this crispr