ID: 1005996113

View in Genome Browser
Species Human (GRCh38)
Location 6:30932378-30932400
Sequence CTACAGACAGGGAAATGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005996101_1005996113 18 Left 1005996101 6:30932337-30932359 CCTCCCTTGTGTCTCCAGGTTTG 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1005996113 6:30932378-30932400 CTACAGACAGGGAAATGGAGAGG No data
1005996100_1005996113 19 Left 1005996100 6:30932336-30932358 CCCTCCCTTGTGTCTCCAGGTTT 0: 1
1: 0
2: 0
3: 22
4: 640
Right 1005996113 6:30932378-30932400 CTACAGACAGGGAAATGGAGAGG No data
1005996106_1005996113 4 Left 1005996106 6:30932351-30932373 CCAGGTTTGAGGGAGTGAGTGCG 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1005996113 6:30932378-30932400 CTACAGACAGGGAAATGGAGAGG No data
1005996097_1005996113 23 Left 1005996097 6:30932332-30932354 CCACCCCTCCCTTGTGTCTCCAG 0: 1
1: 0
2: 4
3: 51
4: 480
Right 1005996113 6:30932378-30932400 CTACAGACAGGGAAATGGAGAGG No data
1005996099_1005996113 20 Left 1005996099 6:30932335-30932357 CCCCTCCCTTGTGTCTCCAGGTT 0: 1
1: 1
2: 0
3: 23
4: 279
Right 1005996113 6:30932378-30932400 CTACAGACAGGGAAATGGAGAGG No data
1005996096_1005996113 24 Left 1005996096 6:30932331-30932353 CCCACCCCTCCCTTGTGTCTCCA 0: 1
1: 0
2: 2
3: 55
4: 487
Right 1005996113 6:30932378-30932400 CTACAGACAGGGAAATGGAGAGG No data
1005996104_1005996113 14 Left 1005996104 6:30932341-30932363 CCTTGTGTCTCCAGGTTTGAGGG 0: 1
1: 0
2: 13
3: 88
4: 360
Right 1005996113 6:30932378-30932400 CTACAGACAGGGAAATGGAGAGG No data
1005996102_1005996113 15 Left 1005996102 6:30932340-30932362 CCCTTGTGTCTCCAGGTTTGAGG 0: 1
1: 0
2: 3
3: 21
4: 206
Right 1005996113 6:30932378-30932400 CTACAGACAGGGAAATGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005996113 Original CRISPR CTACAGACAGGGAAATGGAG AGG Intergenic
No off target data available for this crispr