ID: 1005999729

View in Genome Browser
Species Human (GRCh38)
Location 6:30955650-30955672
Sequence CCCGGCAGCCTCCTGCCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005999729_1005999739 14 Left 1005999729 6:30955650-30955672 CCCGAGGGCAGGAGGCTGCCGGG No data
Right 1005999739 6:30955687-30955709 TGTCCCGGCGGAGTCGCAGCGGG No data
1005999729_1005999735 -1 Left 1005999729 6:30955650-30955672 CCCGAGGGCAGGAGGCTGCCGGG No data
Right 1005999735 6:30955672-30955694 GGCGCCGGAAGCTGCTGTCCCGG No data
1005999729_1005999740 15 Left 1005999729 6:30955650-30955672 CCCGAGGGCAGGAGGCTGCCGGG No data
Right 1005999740 6:30955688-30955710 GTCCCGGCGGAGTCGCAGCGGGG No data
1005999729_1005999741 16 Left 1005999729 6:30955650-30955672 CCCGAGGGCAGGAGGCTGCCGGG No data
Right 1005999741 6:30955689-30955711 TCCCGGCGGAGTCGCAGCGGGGG No data
1005999729_1005999738 13 Left 1005999729 6:30955650-30955672 CCCGAGGGCAGGAGGCTGCCGGG No data
Right 1005999738 6:30955686-30955708 CTGTCCCGGCGGAGTCGCAGCGG No data
1005999729_1005999736 2 Left 1005999729 6:30955650-30955672 CCCGAGGGCAGGAGGCTGCCGGG No data
Right 1005999736 6:30955675-30955697 GCCGGAAGCTGCTGTCCCGGCGG No data
1005999729_1005999744 22 Left 1005999729 6:30955650-30955672 CCCGAGGGCAGGAGGCTGCCGGG No data
Right 1005999744 6:30955695-30955717 CGGAGTCGCAGCGGGGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005999729 Original CRISPR CCCGGCAGCCTCCTGCCCTC GGG (reversed) Intergenic
No off target data available for this crispr