ID: 1005999734

View in Genome Browser
Species Human (GRCh38)
Location 6:30955668-30955690
Sequence GACAGCAGCTTCCGGCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005999734_1005999739 -4 Left 1005999734 6:30955668-30955690 CCGGGGCGCCGGAAGCTGCTGTC No data
Right 1005999739 6:30955687-30955709 TGTCCCGGCGGAGTCGCAGCGGG No data
1005999734_1005999745 20 Left 1005999734 6:30955668-30955690 CCGGGGCGCCGGAAGCTGCTGTC No data
Right 1005999745 6:30955711-30955733 GCTCCGGTTCCCCGAGACTGCGG No data
1005999734_1005999744 4 Left 1005999734 6:30955668-30955690 CCGGGGCGCCGGAAGCTGCTGTC No data
Right 1005999744 6:30955695-30955717 CGGAGTCGCAGCGGGGGCTCCGG No data
1005999734_1005999738 -5 Left 1005999734 6:30955668-30955690 CCGGGGCGCCGGAAGCTGCTGTC No data
Right 1005999738 6:30955686-30955708 CTGTCCCGGCGGAGTCGCAGCGG No data
1005999734_1005999741 -2 Left 1005999734 6:30955668-30955690 CCGGGGCGCCGGAAGCTGCTGTC No data
Right 1005999741 6:30955689-30955711 TCCCGGCGGAGTCGCAGCGGGGG No data
1005999734_1005999740 -3 Left 1005999734 6:30955668-30955690 CCGGGGCGCCGGAAGCTGCTGTC No data
Right 1005999740 6:30955688-30955710 GTCCCGGCGGAGTCGCAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005999734 Original CRISPR GACAGCAGCTTCCGGCGCCC CGG (reversed) Intergenic
No off target data available for this crispr