ID: 1005999737

View in Genome Browser
Species Human (GRCh38)
Location 6:30955676-30955698
Sequence TCCGCCGGGACAGCAGCTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005999737_1005999744 -4 Left 1005999737 6:30955676-30955698 CCGGAAGCTGCTGTCCCGGCGGA No data
Right 1005999744 6:30955695-30955717 CGGAGTCGCAGCGGGGGCTCCGG No data
1005999737_1005999741 -10 Left 1005999737 6:30955676-30955698 CCGGAAGCTGCTGTCCCGGCGGA No data
Right 1005999741 6:30955689-30955711 TCCCGGCGGAGTCGCAGCGGGGG No data
1005999737_1005999745 12 Left 1005999737 6:30955676-30955698 CCGGAAGCTGCTGTCCCGGCGGA No data
Right 1005999745 6:30955711-30955733 GCTCCGGTTCCCCGAGACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005999737 Original CRISPR TCCGCCGGGACAGCAGCTTC CGG (reversed) Intergenic
No off target data available for this crispr