ID: 1005999742

View in Genome Browser
Species Human (GRCh38)
Location 6:30955690-30955712
Sequence GCCCCCGCTGCGACTCCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005999742_1005999745 -2 Left 1005999742 6:30955690-30955712 CCCGGCGGAGTCGCAGCGGGGGC No data
Right 1005999745 6:30955711-30955733 GCTCCGGTTCCCCGAGACTGCGG No data
1005999742_1005999750 18 Left 1005999742 6:30955690-30955712 CCCGGCGGAGTCGCAGCGGGGGC No data
Right 1005999750 6:30955731-30955753 CGGCCCTCCCTCGTTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005999742 Original CRISPR GCCCCCGCTGCGACTCCGCC GGG (reversed) Intergenic
No off target data available for this crispr