ID: 1005999744

View in Genome Browser
Species Human (GRCh38)
Location 6:30955695-30955717
Sequence CGGAGTCGCAGCGGGGGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005999727_1005999744 23 Left 1005999727 6:30955649-30955671 CCCCGAGGGCAGGAGGCTGCCGG No data
Right 1005999744 6:30955695-30955717 CGGAGTCGCAGCGGGGGCTCCGG No data
1005999731_1005999744 21 Left 1005999731 6:30955651-30955673 CCGAGGGCAGGAGGCTGCCGGGG No data
Right 1005999744 6:30955695-30955717 CGGAGTCGCAGCGGGGGCTCCGG No data
1005999737_1005999744 -4 Left 1005999737 6:30955676-30955698 CCGGAAGCTGCTGTCCCGGCGGA No data
Right 1005999744 6:30955695-30955717 CGGAGTCGCAGCGGGGGCTCCGG No data
1005999729_1005999744 22 Left 1005999729 6:30955650-30955672 CCCGAGGGCAGGAGGCTGCCGGG No data
Right 1005999744 6:30955695-30955717 CGGAGTCGCAGCGGGGGCTCCGG No data
1005999734_1005999744 4 Left 1005999734 6:30955668-30955690 CCGGGGCGCCGGAAGCTGCTGTC No data
Right 1005999744 6:30955695-30955717 CGGAGTCGCAGCGGGGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005999744 Original CRISPR CGGAGTCGCAGCGGGGGCTC CGG Intergenic
No off target data available for this crispr