ID: 1006003791

View in Genome Browser
Species Human (GRCh38)
Location 6:30987089-30987111
Sequence GGCCCCACTGGAGGTCGTAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 4, 2: 7, 3: 10, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006003791_1006003798 19 Left 1006003791 6:30987089-30987111 CCAGTACGACCTCCAGTGGGGCC 0: 1
1: 4
2: 7
3: 10
4: 60
Right 1006003798 6:30987131-30987153 ACTCCAGCACAACCTCCAGTGGG 0: 2
1: 5
2: 7
3: 12
4: 155
1006003791_1006003797 18 Left 1006003791 6:30987089-30987111 CCAGTACGACCTCCAGTGGGGCC 0: 1
1: 4
2: 7
3: 10
4: 60
Right 1006003797 6:30987130-30987152 GACTCCAGCACAACCTCCAGTGG 0: 2
1: 5
2: 9
3: 12
4: 168
1006003791_1006003799 20 Left 1006003791 6:30987089-30987111 CCAGTACGACCTCCAGTGGGGCC 0: 1
1: 4
2: 7
3: 10
4: 60
Right 1006003799 6:30987132-30987154 CTCCAGCACAACCTCCAGTGGGG 0: 3
1: 5
2: 7
3: 28
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006003791 Original CRISPR GGCCCCACTGGAGGTCGTAC TGG (reversed) Exonic
1062870294 10:896207-896229 GGCCCCACTGGAAGTGTTTCTGG - Intronic
1074868588 10:117559699-117559721 GGTCCCACTGGTGGTCATGCAGG + Intergenic
1079261302 11:18884558-18884580 GGTCTCACTGGAGCTCCTACAGG - Intergenic
1083915273 11:65739026-65739048 GGCCCCACTCCTGGTGGTACTGG + Intergenic
1085024850 11:73230386-73230408 GGCCACAGTGGAGGTGGGACTGG - Intronic
1104036782 12:125103116-125103138 GGACCCACTGGAGCTCCTGCGGG + Intronic
1104467100 12:128999545-128999567 GGCCCCACTGGGGCTGGGACCGG - Intergenic
1106878121 13:34098330-34098352 GGCACCTCTGGAGGTGATACAGG + Intergenic
1113750048 13:112770683-112770705 GGCCCCTCTGGTGGGCGTGCGGG - Intronic
1115645367 14:35365530-35365552 GGCCCCACGGGAGGTGGGCCTGG - Intergenic
1122264096 14:100538658-100538680 GGCCCCGCTGGAGGCCGAAGTGG - Exonic
1124566910 15:30824477-30824499 GGCCCGACTGGGGGTGGTAGTGG + Intergenic
1125381216 15:39089263-39089285 GGCCCAGCTGGAGGTCCTAAGGG - Intergenic
1125721483 15:41847218-41847240 GGCCCCACTGGAGACCGTTTTGG + Intronic
1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG + Intronic
1133651418 16:7817058-7817080 GACCCCACTGGAAATCGGACCGG + Intergenic
1139670966 16:68492402-68492424 GGCCCCACTGGTGGTGCCACAGG - Intergenic
1146646707 17:34581183-34581205 GGCGCCACTGGAGGGGGTACGGG + Intronic
1147190453 17:38735331-38735353 GGCCCCACTGGCTGTCGAAGGGG + Exonic
1158452728 18:57581278-57581300 GGCCCCACAGGAGGTGGCAGTGG + Intronic
1161321614 19:3644114-3644136 GGGCCCCCCGCAGGTCGTACTGG + Exonic
1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG + Intronic
1164896254 19:31880014-31880036 GGCCCTACTGGAGGCAGTTCTGG - Intergenic
1166204743 19:41262419-41262441 GCCGCCACTGGAGGGCGTCCGGG - Intergenic
932612246 2:73208446-73208468 GGCCCCAACGGAGGACCTACAGG + Exonic
936093731 2:109516559-109516581 GCCGCCACTGGAGGGCGTGCTGG + Intergenic
938189388 2:129261979-129262001 GGCTCCACTGGAAGTGGTAAGGG + Intergenic
944817650 2:203394728-203394750 GGTACCACTGGAGGACGCACTGG - Exonic
1171817987 20:29805454-29805476 GGCCCCACTGCATGTTGTTCTGG + Intergenic
1171900253 20:30849824-30849846 GGCCCCACTGCATGTTGTTCTGG - Intergenic
1175121491 20:56719405-56719427 GGCACCACTGAAGGTTGGACTGG + Intergenic
1178887574 21:36495945-36495967 GGCCCCACTGGAAGTTGGAAGGG + Intronic
1180321433 22:11324938-11324960 GGCCCCACTGCATGTTGTTCTGG + Intergenic
1180707240 22:17817357-17817379 GGCCCCGCTGGAGGGGGTGCTGG + Exonic
1181745913 22:24954728-24954750 ACCCCCACTGGAGGTCCTAGGGG + Intronic
950839910 3:15957934-15957956 GGCCCAAAGGGAGGTAGTACAGG - Intergenic
952432360 3:33235971-33235993 GACCCCACTGGAGATTGAACTGG + Intergenic
954449558 3:50564273-50564295 GGGACCACTGGAGATCGTGCAGG - Intronic
959996908 3:112690244-112690266 GGCCCCAGTGCAGGTTGCACAGG + Intergenic
961541954 3:127606227-127606249 GGCTGCCCTGGAGGTGGTACTGG + Exonic
968442924 4:633681-633703 GTGCCCACTGCAGGTCGCACAGG + Intronic
968902195 4:3437005-3437027 GGCCCCTCTGGAGGTGGTGCAGG + Intronic
969347488 4:6578528-6578550 AGCCCCACTGGAGGTCCTGAGGG - Intronic
971967263 4:33576629-33576651 TGCCCCACTGTAGGTGGAACAGG + Intergenic
975361538 4:73476905-73476927 GGTCCCACTGGTGGTCGTGTTGG + Intergenic
985442422 4:189992720-189992742 GGCCCCACTGCATGTTGTTCTGG + Intergenic
997751109 5:136346745-136346767 TGCCCTACTGGAGGTCTTCCTGG + Intronic
1001572899 5:172742196-172742218 GGCCCCACTGGAAGAAGTAGGGG - Intergenic
1006003639 6:30986279-30986301 GGCTCCACTGGAGATCACACTGG - Exonic
1006003649 6:30986324-30986346 GACCCCACTGGAGGTCACACTGG - Exonic
1006003678 6:30986504-30986526 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003687 6:30986549-30986571 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003697 6:30986594-30986616 AGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003703 6:30986639-30986661 GGCCTCACTGGAGGTTGTGCTGG - Exonic
1006003712 6:30986684-30986706 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003728 6:30986774-30986796 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003737 6:30986819-30986841 AGCCCCATTGGAGGTCGTTCTGG - Exonic
1006003746 6:30986864-30986886 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003755 6:30986909-30986931 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003766 6:30986954-30986976 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003781 6:30987044-30987066 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003791 6:30987089-30987111 GGCCCCACTGGAGGTCGTACTGG - Exonic
1006003800 6:30987134-30987156 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003809 6:30987179-30987201 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003818 6:30987224-30987246 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003828 6:30987269-30987291 GGTCCCACTGGAGGTCGTGCTGG - Exonic
1006003846 6:30987359-30987381 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003863 6:30987449-30987471 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1007636722 6:43304089-43304111 GGCCCCACTGGCGGCCTTGCTGG + Exonic
1012973210 6:105753471-105753493 GGCACCACAGGAGGTGATACCGG + Intergenic
1013962294 6:115914958-115914980 GCCCCCACTGAAGGTGGTATTGG - Intergenic
1021923987 7:25517583-25517605 GGCTTCACTGAAGGTCCTACTGG + Intergenic
1039464925 8:37778074-37778096 GGCCCCGCTGGAGGTGGCACAGG + Exonic
1039589692 8:38736009-38736031 GGAGCCACTGGAGGGAGTACCGG - Intronic
1048177181 8:132163371-132163393 GGCCCCATGGGAGGTCATGCTGG - Intronic
1050992751 9:12173545-12173567 GGCCCCACTCCTGGTGGTACTGG + Intergenic
1052534227 9:29727002-29727024 AGCCACACTGGAGGTAGTATTGG - Intergenic
1053225407 9:36351167-36351189 GGGCCCACTGCAGGTGGCACTGG + Exonic
1060547331 9:124469113-124469135 TCCCCTACTGGAGGTTGTACTGG - Intronic
1203369650 Un_KI270442v1:290718-290740 GGCCCCACTGCATGTTGTTCTGG + Intergenic
1195447981 X:104975740-104975762 GGCCCCTCTCCAGGTGGTACTGG + Intronic
1198135832 X:133749409-133749431 AGCACCACTGGAGGTGGTAAAGG - Intronic