ID: 1006003828

View in Genome Browser
Species Human (GRCh38)
Location 6:30987269-30987291
Sequence GGTCCCACTGGAGGTCGTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 4, 2: 9, 3: 17, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006003828_1006003834 18 Left 1006003828 6:30987269-30987291 CCAGCACGACCTCCAGTGGGACC 0: 1
1: 4
2: 9
3: 17
4: 99
Right 1006003834 6:30987310-30987332 GAGTCCAGCACAGTGTCCAGTGG 0: 3
1: 1
2: 1
3: 29
4: 192
1006003828_1006003836 20 Left 1006003828 6:30987269-30987291 CCAGCACGACCTCCAGTGGGACC 0: 1
1: 4
2: 9
3: 17
4: 99
Right 1006003836 6:30987312-30987334 GTCCAGCACAGTGTCCAGTGGGG 0: 2
1: 2
2: 0
3: 31
4: 212
1006003828_1006003835 19 Left 1006003828 6:30987269-30987291 CCAGCACGACCTCCAGTGGGACC 0: 1
1: 4
2: 9
3: 17
4: 99
Right 1006003835 6:30987311-30987333 AGTCCAGCACAGTGTCCAGTGGG 0: 4
1: 1
2: 1
3: 16
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006003828 Original CRISPR GGTCCCACTGGAGGTCGTGC TGG (reversed) Exonic
900093704 1:931706-931728 GGTCCCTCTGGAGGCCTTCCTGG + Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
902396474 1:16134740-16134762 GGTCTCACGGGAGGTATTGCAGG + Intronic
902470841 1:16646887-16646909 TGTCCCACTGGTGATCGTTCGGG - Intergenic
906239668 1:44235090-44235112 GGAGCCACTGGAAGTGGTGCTGG - Intronic
907413254 1:54297128-54297150 GTTCCCACTGGAGGTGGTGGTGG - Intronic
913335094 1:117702654-117702676 GATCCCACTGGAGGTCCGGCTGG - Intergenic
1062794814 10:336749-336771 TGTCCCACTGGAGGGCCTTCAGG - Intronic
1070151519 10:73808174-73808196 GGTGGAACTGGAGGCCGTGCAGG + Exonic
1070765121 10:79052026-79052048 GGGCCCACTGCAGGGCGTGTTGG - Intergenic
1074868588 10:117559699-117559721 GGTCCCACTGGTGGTCATGCAGG + Intergenic
1079010773 11:16826394-16826416 GGACCCACTGGAGGGCAAGCGGG - Exonic
1079261302 11:18884558-18884580 GGTCTCACTGGAGCTCCTACAGG - Intergenic
1081600370 11:44488536-44488558 GGTGCCACTGGGGCTGGTGCTGG - Intergenic
1087309239 11:96521180-96521202 GGTTGCACTGGAGGTGGTGCTGG + Intergenic
1087378005 11:97368160-97368182 GGGCACACTGGAGGTGGTGTTGG - Intergenic
1089910924 11:122100394-122100416 GGTGCCACAGGAGGCTGTGCGGG - Intergenic
1090670067 11:128939908-128939930 GGTCCCAGCGGAGTTCATGCCGG + Intronic
1098678627 12:73321930-73321952 GGTTGCACTGGAGGTGGTGTAGG - Intergenic
1103377527 12:120468958-120468980 GATGCCGCTGGAGGTCGTGGAGG - Intronic
1104036782 12:125103116-125103138 GGACCCACTGGAGCTCCTGCGGG + Intronic
1104976014 12:132552339-132552361 CGTCCCTCTGGCTGTCGTGCTGG - Intronic
1108211032 13:48139916-48139938 GGTGCAACTGCAGGTCGTTCAGG - Intergenic
1112324239 13:98432818-98432840 GGACCCACTGGAGGGTCTGCAGG + Intronic
1113231706 13:108218804-108218826 GCTTCCCCTGGGGGTCGTGCGGG + Intronic
1113750048 13:112770683-112770705 GGCCCCTCTGGTGGGCGTGCGGG - Intronic
1117803272 14:59465526-59465548 GGTCCCTCAGGAGGTCGACCTGG - Intronic
1122372476 14:101236199-101236221 GGGCCCTCAGGAGGTCGGGCAGG + Intergenic
1123131894 14:105994062-105994084 GGTCACACTGGAGGAGGTGTTGG + Intergenic
1128133479 15:65246078-65246100 GGTCTGCCTGGAGGTCATGCTGG - Intronic
1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG + Intronic
1132000099 15:98170110-98170132 TGTCCCACTGGAAGTCGTCAAGG - Intergenic
1139434258 16:66926979-66927001 CTTCCCACTGGAGTTCGTTCAGG - Intergenic
1143634472 17:8156461-8156483 GGTGCCAATGGAGGCTGTGCGGG - Intronic
1144706294 17:17370648-17370670 GTTCCACCTGGAGGTCTTGCAGG + Intergenic
1151729378 17:75901894-75901916 TGTCCCGCTGGATGCCGTGCGGG - Exonic
1154454541 18:14509239-14509261 TGTTGCACTGGAGGTAGTGCTGG + Intronic
1158657233 18:59349112-59349134 GCTGCAACTGGAGGTCTTGCAGG - Exonic
1160237172 18:77094963-77094985 CATCCCACTGGAGGTGCTGCAGG + Intronic
1163428989 19:17255594-17255616 GGTCCCACAGGAGGCCCTGGCGG - Exonic
1164617155 19:29674091-29674113 GGTCACACTGGAGCTGTTGCCGG + Exonic
1164924718 19:32120644-32120666 GGTCGCGCTGGTGGTCCTGCCGG + Intergenic
1166232480 19:41433264-41433286 GGTCTCACTGGAGGTGGTGGAGG + Exonic
1168393295 19:56028171-56028193 GAGGCCACTGGAGGTCCTGCTGG + Exonic
931769996 2:65489161-65489183 GGTCCCACTGGACCCTGTGCTGG + Intergenic
936093731 2:109516559-109516581 GCCGCCACTGGAGGGCGTGCTGG + Intergenic
944817650 2:203394728-203394750 GGTACCACTGGAGGACGCACTGG - Exonic
944921745 2:204421305-204421327 GGTCCCTCTGGAGGTGGAGGTGG - Intergenic
944995798 2:205292102-205292124 GGTCCCACTGGAGCTCTACCTGG - Intronic
1171053381 20:21882879-21882901 GGTCATACTGGAGGTGGTGTTGG + Intergenic
1171516935 20:25745741-25745763 GGACTCACTGGAGGTAGTGGGGG + Intergenic
1175835547 20:61991831-61991853 CATCCCACTGGAGTGCGTGCTGG - Intronic
1176125762 20:63473760-63473782 GGTCCCTCTGGAGCTGCTGCTGG + Intergenic
1176819627 21:13644069-13644091 TGTTGCACTGGAGGTAGTGCTGG - Intergenic
1180647042 22:17347835-17347857 GGTCCCAGTGGACGTGGTGCGGG - Intergenic
1180707240 22:17817357-17817379 GGCCCCGCTGGAGGGGGTGCTGG + Exonic
1184279139 22:43427136-43427158 GGTCCCACTGTATGTGGTGCTGG - Intronic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1185156443 22:49196021-49196043 GGTCACACAGGAGGTCAGGCTGG + Intergenic
950419879 3:12892546-12892568 GGTCCCTGTGGAGGTCCTGGGGG - Intergenic
950923036 3:16715016-16715038 TGTTGCACTGGAGGTGGTGCTGG + Intergenic
954449558 3:50564273-50564295 GGGACCACTGGAGATCGTGCAGG - Intronic
954861593 3:53695168-53695190 GGTCCCCGTGGAGGAGGTGCTGG + Intronic
955330267 3:58041530-58041552 AGTCCCACTGGTGGTGGTGGTGG - Intronic
968902195 4:3437005-3437027 GGCCCCTCTGGAGGTGGTGCAGG + Intronic
969297366 4:6277883-6277905 GCACCCACTCGAGGTGGTGCTGG + Intronic
969347488 4:6578528-6578550 AGCCCCACTGGAGGTCCTGAGGG - Intronic
969466056 4:7357096-7357118 GGTCCGGCTGGAGCTCTTGCTGG + Intronic
975361538 4:73476905-73476927 GGTCCCACTGGTGGTCGTGTTGG + Intergenic
976948436 4:90799125-90799147 GGTCACACTGGAGGTGATGTTGG + Intronic
978854734 4:113381562-113381584 GATCGCGCTGGAGGTCGTCCTGG - Exonic
983420147 4:167506725-167506747 TGTCGCACTGGAGGTGGTGTTGG + Intergenic
983858531 4:172675483-172675505 GGTGGCACTGGAGGTGGTGTTGG + Intronic
986098133 5:4580363-4580385 TGACCCACTGGAGGTTGTGGAGG + Intergenic
986258231 5:6119944-6119966 TAACCCACTGGAGGTCCTGCAGG + Intergenic
990781767 5:59372652-59372674 AGTCACACTGGAGGTGGTGTTGG - Intronic
995353132 5:111205346-111205368 GGTCCCTCTGGAGGAGCTGCTGG - Intergenic
998212764 5:140213143-140213165 TGTCCCACTGGAGGTCTTCAGGG - Intronic
1000121132 5:158198899-158198921 GCTCACACTGCAGGTAGTGCAGG - Intergenic
1002451655 5:179322395-179322417 GGTCACACAGGAGGGAGTGCAGG + Intronic
1002713712 5:181211395-181211417 ATACCCACTGGAGGGCGTGCAGG + Intergenic
1002991820 6:2245580-2245602 GGGCGCACGGGAGGCCGTGCAGG + Exonic
1006003678 6:30986504-30986526 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003687 6:30986549-30986571 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003697 6:30986594-30986616 AGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003703 6:30986639-30986661 GGCCTCACTGGAGGTTGTGCTGG - Exonic
1006003712 6:30986684-30986706 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003728 6:30986774-30986796 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003737 6:30986819-30986841 AGCCCCATTGGAGGTCGTTCTGG - Exonic
1006003746 6:30986864-30986886 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003755 6:30986909-30986931 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003766 6:30986954-30986976 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003781 6:30987044-30987066 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003791 6:30987089-30987111 GGCCCCACTGGAGGTCGTACTGG - Exonic
1006003800 6:30987134-30987156 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003809 6:30987179-30987201 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003818 6:30987224-30987246 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003828 6:30987269-30987291 GGTCCCACTGGAGGTCGTGCTGG - Exonic
1006003846 6:30987359-30987381 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003863 6:30987449-30987471 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1007468901 6:42075338-42075360 GGTCCCACTGGATTGGGTGCTGG + Intronic
1007636722 6:43304089-43304111 GGCCCCACTGGCGGCCTTGCTGG + Exonic
1009557887 6:65198215-65198237 TGTCCCACTGGAAGGTGTGCAGG + Intronic
1013411010 6:109883280-109883302 TGTCCCACTGGAGGTCTTCAGGG + Intergenic
1017750474 6:157486705-157486727 CTTCCCAGAGGAGGTCGTGCTGG + Intronic
1018308117 6:162479637-162479659 GGTCCCACTGGAGGGTCTTCAGG + Intronic
1018859755 6:167703035-167703057 GGTCCCACTGGAAGGTCTGCAGG + Intergenic
1018908796 6:168090123-168090145 GGTCCCAGTGGTGGACGTGGAGG - Intergenic
1027330180 7:77084455-77084477 GTTCCCACTAGTGCTCGTGCTGG + Intergenic
1029785583 7:102786877-102786899 GCTCCCACTAGTGCTCGTGCTGG - Intronic
1030697654 7:112603737-112603759 AGTCCCACAGGAGGTAATGCTGG + Intergenic
1033059617 7:138093550-138093572 CGTCCCACTGGAGGTTCTTCCGG + Intronic
1034189904 7:149205977-149205999 GGTCCAAGTTGAGGTCGTGCTGG + Intronic
1034549090 7:151809007-151809029 CGTCCCCCTGGAGTTCGTGTTGG + Intronic
1034699427 7:153083555-153083577 GGTGCTACTGGAGGTCGGCCCGG - Intergenic
1035625780 8:1069363-1069385 GGTCTCACTGGAGGACGGGCCGG + Intergenic
1038328310 8:26588812-26588834 GGGCTCGCTGGAGGTTGTGCTGG + Intronic
1039517568 8:38146375-38146397 GTTCCGGCTGGAGGTCGTGGTGG - Exonic
1044793549 8:95872643-95872665 GGTCACACTGGTGGTGGTGTTGG - Intergenic
1048177181 8:132163371-132163393 GGCCCCATGGGAGGTCATGCTGG - Intronic
1049670980 8:143869755-143869777 GGGCCTGCTGGAGGACGTGCAGG - Exonic
1049708466 8:144053313-144053335 GGTCCGACAGGTTGTCGTGCAGG + Exonic
1051604230 9:18905014-18905036 GGTTCCACTGGGGGTGGTGCTGG - Intronic
1203527733 Un_GL000213v1:105501-105523 TGTTGCACTGGAGGTAGTGCTGG + Intergenic
1185593187 X:1291963-1291985 GGTCCAGGTGGAGGTGGTGCAGG - Intronic
1185593211 X:1292088-1292110 GGTCCAGGTGGAGGTGGTGCAGG - Intronic
1187473279 X:19588274-19588296 TGTCCCCCTGGATGTTGTGCCGG - Intronic
1190245272 X:48686774-48686796 GGACCCACTGGAGGGCCTGTGGG - Exonic
1194663929 X:96656306-96656328 GGTTGCACTGGAGGTGGTGTTGG - Intergenic
1201068650 Y:10124309-10124331 GGTCCCACTGCATGTTGTTCTGG - Intergenic