ID: 1006010838

View in Genome Browser
Species Human (GRCh38)
Location 6:31041839-31041861
Sequence GCCGCTCCTTCAGTTGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006010838_1006010842 -1 Left 1006010838 6:31041839-31041861 CCAAAGACAACTGAAGGAGCGGC No data
Right 1006010842 6:31041861-31041883 CAGAAAACAAATATGGGAACGGG No data
1006010838_1006010845 30 Left 1006010838 6:31041839-31041861 CCAAAGACAACTGAAGGAGCGGC No data
Right 1006010845 6:31041892-31041914 CTTCCAGTTCCTTCATTCGCAGG No data
1006010838_1006010844 7 Left 1006010838 6:31041839-31041861 CCAAAGACAACTGAAGGAGCGGC No data
Right 1006010844 6:31041869-31041891 AAATATGGGAACGGGGTAATTGG No data
1006010838_1006010841 -2 Left 1006010838 6:31041839-31041861 CCAAAGACAACTGAAGGAGCGGC No data
Right 1006010841 6:31041860-31041882 GCAGAAAACAAATATGGGAACGG No data
1006010838_1006010839 -8 Left 1006010838 6:31041839-31041861 CCAAAGACAACTGAAGGAGCGGC No data
Right 1006010839 6:31041854-31041876 GGAGCGGCAGAAAACAAATATGG No data
1006010838_1006010840 -7 Left 1006010838 6:31041839-31041861 CCAAAGACAACTGAAGGAGCGGC No data
Right 1006010840 6:31041855-31041877 GAGCGGCAGAAAACAAATATGGG No data
1006010838_1006010843 0 Left 1006010838 6:31041839-31041861 CCAAAGACAACTGAAGGAGCGGC No data
Right 1006010843 6:31041862-31041884 AGAAAACAAATATGGGAACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006010838 Original CRISPR GCCGCTCCTTCAGTTGTCTT TGG (reversed) Intergenic
No off target data available for this crispr