ID: 1006018741

View in Genome Browser
Species Human (GRCh38)
Location 6:31104051-31104073
Sequence TTGGGGAAGCTGAGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006018741_1006018747 -7 Left 1006018741 6:31104051-31104073 CCCTCCTGCCTCAGCTTCCCCAA No data
Right 1006018747 6:31104067-31104089 TCCCCAAGTGCTGGGATTATAGG 0: 166
1: 29818
2: 324695
3: 254543
4: 150332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006018741 Original CRISPR TTGGGGAAGCTGAGGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr