ID: 1006021327

View in Genome Browser
Species Human (GRCh38)
Location 6:31119448-31119470
Sequence GGTCCAGGGGTTGCCCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006021317_1006021327 14 Left 1006021317 6:31119411-31119433 CCTCAAGGGCTATAAGTACCCGG 0: 1
1: 0
2: 0
3: 0
4: 65
Right 1006021327 6:31119448-31119470 GGTCCAGGGGTTGCCCGGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 199
1006021321_1006021327 -4 Left 1006021321 6:31119429-31119451 CCCGGTGGTCAACAACACAGGTC 0: 1
1: 0
2: 0
3: 13
4: 107
Right 1006021327 6:31119448-31119470 GGTCCAGGGGTTGCCCGGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 199
1006021322_1006021327 -5 Left 1006021322 6:31119430-31119452 CCGGTGGTCAACAACACAGGTCC 0: 1
1: 0
2: 2
3: 6
4: 93
Right 1006021327 6:31119448-31119470 GGTCCAGGGGTTGCCCGGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006021327 Original CRISPR GGTCCAGGGGTTGCCCGGCC TGG Intronic
900185752 1:1332455-1332477 GGTCATGGGGCTGCCCGGCATGG + Exonic
900329334 1:2126317-2126339 GCTGCAGGGGCTGCCCGGCTGGG + Intronic
900342360 1:2194998-2195020 GGCCCGGGGGCTGCCCGGACGGG - Intronic
900428651 1:2591973-2591995 GGACCAGCAGCTGCCCGGCCTGG - Exonic
900544362 1:3220308-3220330 GGTCCTGGGGCTGCCCTGGCCGG - Intronic
900770926 1:4543434-4543456 GGTCCAGGTGTTGGCAGGGCTGG - Intergenic
901039918 1:6357660-6357682 GGGACAGGGGTTGCCCTTCCCGG + Intronic
901222028 1:7588646-7588668 GGCCCTGGGGTTGCCCTGCAAGG - Intronic
901279783 1:8025704-8025726 GCTCGCGGGGTTGCCCGGCGGGG - Intronic
901534423 1:9873030-9873052 GGTCCAGGGTTTGCTGGTCCTGG - Intronic
901551462 1:9998334-9998356 GGTTCAGGGATTGGCCGGCACGG - Intronic
902732155 1:18376716-18376738 GGGTCAGGGGCTGCCTGGCCAGG - Intronic
902825377 1:18969893-18969915 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
902983663 1:20142575-20142597 TGTCCTGGGGTGGGCCGGCCTGG + Intronic
905031369 1:34886198-34886220 GGTCCAGGGCGTCCACGGCCTGG + Exonic
906038506 1:42767573-42767595 GGTCTAAGGGGTCCCCGGCCCGG - Exonic
906107765 1:43305008-43305030 GGCGCAGGGGTGGCCCGGGCGGG - Exonic
913957141 1:143317175-143317197 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
914050229 1:144125198-144125220 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
914051455 1:144142539-144142561 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
914127742 1:144824002-144824024 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
914128953 1:144840247-144840269 GGTCCAGGGGTTGCAGGGGAGGG - Intergenic
915722601 1:157995369-157995391 GGCCCTGGGGTTGGCAGGCCAGG + Intronic
917944519 1:179955039-179955061 GGCCCCAGGGCTGCCCGGCCTGG - Exonic
919751569 1:201041156-201041178 TGTCCAGGGGCTGCCCTTCCAGG + Intronic
1067060775 10:43076986-43077008 GGTCCAGGGGTGGGCCAGGCGGG - Intergenic
1067163824 10:43849025-43849047 AGTCCAGGGCTTGCCCTTCCTGG + Intergenic
1070327683 10:75399186-75399208 GGTAGAGGGGGTGGCCGGCCAGG + Exonic
1071579620 10:86757021-86757043 GAGCCAGGGGCTGCCCGGCCCGG + Intronic
1073582680 10:104682316-104682338 GGTCCTGGGGCTGCATGGCCTGG + Intronic
1074772647 10:116743338-116743360 GACCCAGGGGGTGCCTGGCCAGG - Intergenic
1074832031 10:117255918-117255940 GGTCCTGGGGATGCCCGGCTGGG + Intronic
1075521669 10:123147286-123147308 GGGCCATGGGCTACCCGGCCAGG + Intergenic
1076541746 10:131219363-131219385 GGTCCTGGGGTCGGCCAGCCAGG - Intronic
1076771637 10:132669319-132669341 GCGCCAGGTGTTGCCGGGCCAGG + Intronic
1077338109 11:2014373-2014395 GGTCCAGGGGTCCCATGGCCTGG - Intergenic
1077500811 11:2909116-2909138 CGTCCAGGGGCTGCCCAGGCGGG - Intronic
1077864522 11:6211463-6211485 GGGCCATGGGTGGCCCGGGCTGG - Exonic
1079111309 11:17606625-17606647 GATCCAGGGCCTGCCCTGCCAGG + Intronic
1081715887 11:45250105-45250127 GGGCGAGGGGCTGCCTGGCCTGG + Intronic
1081869637 11:46377444-46377466 GGTCCGGGGGCTGCCAGGACTGG - Intronic
1083203127 11:61132063-61132085 GGTCCCAGGATAGCCCGGCCGGG + Exonic
1083750605 11:64758762-64758784 GGTCCAGGCGTGGCTGGGCCTGG - Intronic
1084155904 11:67312321-67312343 GGGCCACTGGTTGCCTGGCCTGG - Exonic
1085472639 11:76768008-76768030 GGTCCAGGCCTGGCCTGGCCAGG - Intergenic
1089180468 11:116579981-116580003 GCTGCGGGGCTTGCCCGGCCCGG - Intergenic
1202821093 11_KI270721v1_random:69555-69577 GGTCCAGGGGTCCCATGGCCTGG - Intergenic
1092185895 12:6478226-6478248 GGTGCAGGGTGTGCCCAGCCTGG - Intergenic
1094701924 12:32878342-32878364 GGTGCAGGGTGTGCCCAGCCTGG + Exonic
1095176913 12:39103134-39103156 GGTCAAGGCTTTGCCAGGCCTGG + Intergenic
1095869195 12:47007270-47007292 GGACAAGGGGTTGCCCTGACCGG + Intergenic
1096258124 12:50075029-50075051 GGTCCAGGGCTTTCCCTGCTGGG + Intronic
1096526930 12:52215649-52215671 GGTCCAGGGGTTGCTCTGGAAGG - Intergenic
1097194247 12:57235094-57235116 GGTCCAGGGCCTGCCCAGGCTGG - Exonic
1103851526 12:123936640-123936662 GGAGCAGGGGCTGCTCGGCCAGG + Exonic
1104227690 12:126851842-126851864 GGTTCAGGGCTTGGCTGGCCTGG + Intergenic
1104664104 12:130635233-130635255 GGTCCAGGCGCTGGCCCGCCTGG - Intronic
1110147214 13:72206058-72206080 GGTCAAAGGGTTGCCCAGACAGG + Intergenic
1111030650 13:82592786-82592808 GGTCCAAGGATTGGCCTGCCTGG + Intergenic
1113082699 13:106535103-106535125 GCTCCAGCGGTCGCCGGGCCAGG + Exonic
1114621750 14:24100187-24100209 TTTCCAGGGTTTGCCCAGCCAGG - Exonic
1119434951 14:74592454-74592476 AGTCCAAGGGTTGCCCAGCCTGG + Intronic
1121694965 14:95904778-95904800 GGTGGAGGGGCTGCCCGGGCTGG + Intergenic
1202931215 14_KI270725v1_random:32869-32891 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1123420104 15:20124507-20124529 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
1123421208 15:20138809-20138831 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1123443921 15:20307978-20308000 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1123445758 15:20329025-20329047 GGTCCAGGGGTTGCAGGGGAGGG - Intergenic
1123529327 15:21131043-21131065 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
1123530434 15:21145349-21145371 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1129335891 15:74852030-74852052 GGGCCTGGGGCTGCCCTGCCTGG - Intronic
1129393805 15:75233681-75233703 GGTCCAGGTGGGGCCCTGCCTGG + Intergenic
1131509960 15:93044466-93044488 CGCCCCGGGGTTGCCCTGCCTGG + Intronic
1132778947 16:1612570-1612592 GGGGCCGGGGCTGCCCGGCCCGG + Intronic
1132793510 16:1706762-1706784 GGTCCAGGGGTCCCGCGGTCCGG - Intronic
1134482198 16:14629851-14629873 GCCCCGGGGGGTGCCCGGCCCGG + Intronic
1135158750 16:20075036-20075058 GCTCCTGGGGATGCCTGGCCTGG - Intergenic
1136019999 16:27434232-27434254 GGTGCAGGGGTCCCCAGGCCGGG - Intronic
1136610670 16:31363117-31363139 GGTGGAGGGGTTGCCCGGGTTGG + Intronic
1136720987 16:32319583-32319605 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
1136722281 16:32335870-32335892 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1136839372 16:33525869-33525891 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
1136840598 16:33541849-33541871 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1138088363 16:54154440-54154462 GGTTCTGGGGAGGCCCGGCCAGG - Intergenic
1138496583 16:57412697-57412719 AGTCCAGGTGCTGCCCTGCCTGG + Intronic
1139504464 16:67392148-67392170 GGCCCAGGGGGTGGCAGGCCAGG - Intronic
1139592385 16:67940510-67940532 GGGCCAGGGGTAGCCAGGCCTGG - Intronic
1141054516 16:80803692-80803714 GGGGCGGGGGTTGCGCGGCCCGG - Intronic
1141576167 16:84964678-84964700 GGTCCAGGGCTTGGCCAGGCTGG + Intergenic
1141597778 16:85107804-85107826 GGGCCTGGGGCTGCCGGGCCAGG - Intronic
1141629764 16:85280932-85280954 GGTCCTGGCGTTGCCTGCCCAGG + Intergenic
1203004150 16_KI270728v1_random:181894-181916 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1203005445 16_KI270728v1_random:198187-198209 GGTCCAGGGGTTGCAGGGGAGGG - Intergenic
1203135758 16_KI270728v1_random:1718301-1718323 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1203136995 16_KI270728v1_random:1734308-1734330 GGTCCAGGGGTTGCAGGGGAGGG - Intergenic
1203149537 16_KI270728v1_random:1826154-1826176 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
1203150763 16_KI270728v1_random:1842146-1842168 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1142730552 17:1852587-1852609 GGGCCATGGCTTGCCTGGCCTGG - Intronic
1144653607 17:17021753-17021775 GGTGCAGGGCTGGCCTGGCCTGG + Intergenic
1145018383 17:19413123-19413145 GCTTCAGGGCTTGCCGGGCCTGG + Exonic
1145413586 17:22694673-22694695 GCTCCAGGGGCTGCTGGGCCTGG + Intergenic
1145909627 17:28534949-28534971 GGTCCAGGAGGGGCCAGGCCTGG - Exonic
1148035105 17:44654542-44654564 AGCCCAGGAGTTGCCCAGCCAGG - Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1150124868 17:62629129-62629151 GGTTAGGGGGTTACCCGGCCTGG - Intronic
1151267787 17:72969890-72969912 GTTCCAGGGGCTGGCCTGCCAGG - Intronic
1151340119 17:73465772-73465794 GTGCCAGGGGTTGGCCAGCCTGG + Intronic
1152377894 17:79928128-79928150 GGCCCAGAGGCTGCCAGGCCTGG + Intergenic
1154358468 18:13640654-13640676 GGTCCAGGGCTGGCTTGGCCCGG + Intronic
1157691326 18:49684474-49684496 GGTCCAGAAGTTGCAGGGCCAGG + Intergenic
1160114423 18:76064276-76064298 GGGCCAGGGATGGGCCGGCCTGG + Intergenic
1162688839 19:12412225-12412247 GGCCCAGGGGTTACCCAACCAGG - Intronic
1163635568 19:18435715-18435737 GGGCGCGGGGTTGCCCGGCGAGG - Intronic
1164764680 19:30755137-30755159 AGACCAGGGCTTGCCCAGCCTGG + Intergenic
1166863731 19:45823925-45823947 GGGTCAGGTGTTGCCCGGCAGGG + Intronic
1202689636 1_KI270712v1_random:77836-77858 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
926859278 2:17291755-17291777 GGTCCATGGGTGGCCTGGGCAGG + Intergenic
927904305 2:26846600-26846622 TCTCCAGGGCTTGCCCGGACAGG - Intergenic
930096530 2:47570547-47570569 GGCCCAGCGGGTGCCCGGGCAGG + Exonic
931516447 2:63053038-63053060 GGTCCATGGCGGGCCCGGCCAGG - Exonic
931996729 2:67845887-67845909 GGTCCAGGGGAAGCCCTGCCAGG + Intergenic
933684642 2:85133513-85133535 GGGCCCGGCGCTGCCCGGCCGGG - Exonic
933955540 2:87358988-87359010 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
933956783 2:87378186-87378208 GGTCCAGGGGTTGCAGGGGAGGG - Intergenic
934239727 2:90255199-90255221 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
934272267 2:91546546-91546568 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
934323825 2:91987745-91987767 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
934714917 2:96537743-96537765 TGTCTAGGGGTCGCCCGGGCTGG + Intronic
934797590 2:97114050-97114072 GGGCTAGGGGGTGCCCGGCTGGG + Intronic
934990398 2:98916314-98916336 GGACCAGGGGTTGCCCTACAGGG + Intronic
935134124 2:100284435-100284457 GCTCCAGGGGCAGCACGGCCAGG + Exonic
935271396 2:101437225-101437247 AGCCCAGGAGTTGCCCAGCCTGG + Intronic
936073119 2:109384431-109384453 GGTCCAGGGGTGGCCTGAGCTGG + Intronic
936148306 2:109996456-109996478 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
936196371 2:110374912-110374934 GGTCCAGGGGTTGCAGGGGAGGG - Intergenic
936396894 2:112138356-112138378 GGAGGAGGGGCTGCCCGGCCGGG - Intergenic
942251042 2:174047939-174047961 GGCCCTGGGGTGCCCCGGCCAGG + Intergenic
946670320 2:222095970-222095992 GGTCCAGGTGTTGGCAGGGCTGG - Intergenic
947820234 2:233064036-233064058 GGTCCATGGGTTGGCCGAGCCGG + Intronic
948591426 2:239053247-239053269 GGACCCGGGGCTGCCAGGCCAGG - Intronic
948813039 2:240494751-240494773 GGTCAAGGGGTTGTCTTGCCAGG + Intronic
1169092896 20:2872355-2872377 GACTCAGGGGTTGCCCGGTCTGG + Intronic
1171420337 20:25013588-25013610 GGTCCTGGCCATGCCCGGCCAGG + Exonic
1172849750 20:37952948-37952970 GGTTCAGGGGCTGGCTGGCCTGG + Intergenic
1174367367 20:50064667-50064689 GGCCCAGGGGCTGCAGGGCCAGG + Intergenic
1175692459 20:61075457-61075479 GGTCCAAAGGATGCCTGGCCAGG - Intergenic
1176593241 21:8661491-8661513 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1178083397 21:29089208-29089230 GGTCCTGGGGTTGTCTGGCATGG + Intronic
1180058294 21:45371052-45371074 AGTCCAGGCGTTGGCCGGCTGGG - Intergenic
1180276087 22:10638618-10638640 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1180550594 22:16533596-16533618 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1180551783 22:16546727-16546749 GGTCCAGGGGTTGCAGGGGAGGG - Intergenic
1181352223 22:22267196-22267218 GGTCCAGGGGTTGCAGGGGAGGG + Intergenic
1181354072 22:22288215-22288237 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1183831924 22:40422818-40422840 TGGCCAGGGGTTGCCAAGCCAGG + Intronic
1184188336 22:42878960-42878982 GGTCCAGGGCAGCCCCGGCCTGG - Intronic
1184411867 22:44330800-44330822 GGGGCTGGGGTGGCCCGGCCCGG - Intergenic
1184454191 22:44599759-44599781 GTTCCAGGGGTGCCCAGGCCCGG + Intergenic
950726178 3:14918499-14918521 GCACCTGGGGTTGCCCGGGCTGG + Intronic
951072728 3:18351335-18351357 GGTGCAGGGGTCGGCAGGCCTGG + Exonic
952606613 3:35154888-35154910 AATCCAGGGGTTTCCCTGCCTGG - Intergenic
952686075 3:36149597-36149619 GGTCAAGGGGTAGCCCCACCAGG + Intergenic
953636835 3:44671244-44671266 GGACCAGGGGTTGCCAGGGTAGG + Intergenic
954554021 3:51504324-51504346 AGTTCAGGGGTTGCCAGGCGCGG - Intergenic
962808947 3:138945969-138945991 GGTCAAGGGGCTGGCGGGCCCGG - Exonic
965803946 3:172523348-172523370 GGTCCAGGGGGGACCCAGCCTGG - Exonic
968652071 4:1764084-1764106 GGCCCAGGGCTTGCCCCGCTGGG + Intergenic
968663615 4:1809295-1809317 GGGGCACTGGTTGCCCGGCCTGG - Intergenic
975473290 4:74794339-74794361 TGTCTAGGGGCTGCCCGGCCCGG - Exonic
985183093 4:187286852-187286874 GGTTCAGGGCTTGGCTGGCCTGG - Intergenic
985842689 5:2320625-2320647 GGCCCTGGCGTTGCCCAGCCTGG + Intergenic
997652560 5:135533528-135533550 GGTGCAGGGCTTGCTCAGCCAGG - Intergenic
1000970264 5:167706717-167706739 TGTTAAAGGGTTGCCCGGCCGGG + Intronic
1002506248 5:179681090-179681112 TGTCCTGGGGTGGCCTGGCCTGG - Intronic
1003925635 6:10875088-10875110 GGTCCAGGGGTTGCTAAGCTTGG + Intronic
1006021327 6:31119448-31119470 GGTCCAGGGGTTGCCCGGCCTGG + Intronic
1007098119 6:39227085-39227107 GGTCCAGGGGTTAGGCAGCCGGG - Intronic
1007808593 6:44470145-44470167 GGTGCAGGGGCTCCCCAGCCAGG + Intergenic
1019277869 7:185295-185317 GGTCCAGCTGTTGCTCGGGCCGG + Intergenic
1019356580 7:583038-583060 GGTCCGGGGGCTGCCAGGGCCGG + Intronic
1019470741 7:1219192-1219214 GGTGCAGGGGTTGCCACTCCAGG - Intergenic
1019479677 7:1260669-1260691 GCTCCTGCGGGTGCCCGGCCTGG + Intergenic
1019696830 7:2450920-2450942 GGTCCAGGAGATGCCAGGCCAGG - Intergenic
1023031271 7:36092425-36092447 GGTGCAGGGGCTCCCCAGCCTGG + Intergenic
1023987414 7:45104878-45104900 GGTCCAGGGGTTCCCTGGGGTGG - Intronic
1027333231 7:77121843-77121865 GGTCCAGGGGCCTCACGGCCAGG + Intergenic
1029782561 7:102749459-102749481 GGTCCAGGGGCCTCACGGCCAGG - Exonic
1030617794 7:111756564-111756586 TGTCCTGGGGTTGCTCGTCCCGG - Intronic
1031999530 7:128255761-128255783 TCTCCAGGGGGTGCCTGGCCAGG - Exonic
1037835752 8:22213901-22213923 GGTCCAGGGTAGGCCCAGCCAGG + Intergenic
1038486342 8:27937699-27937721 GCTCCAGGGGTTGGCAGGGCTGG + Intronic
1047376456 8:124301651-124301673 GGTCCCGGAGGTCCCCGGCCTGG - Intergenic
1049762159 8:144336567-144336589 GGTGCAGGGCTGGCCCGGCTCGG + Intergenic
1049800813 8:144516746-144516768 GGCCCAGGGCTGGTCCGGCCTGG + Exonic
1053692645 9:40594221-40594243 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1054272172 9:63043312-63043334 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1054303887 9:63395139-63395161 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1054402665 9:64721649-64721671 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1054436276 9:65205980-65206002 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1054494117 9:65815707-65815729 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1057758511 9:97854720-97854742 GGCGGAGGGGTTGGCCGGCCGGG - Exonic
1061479961 9:130892831-130892853 GGCCCAGTGTTAGCCCGGCCAGG - Intergenic
1062398547 9:136362543-136362565 GGTCCGGGCCTTGCCTGGCCGGG - Intronic
1203623283 Un_KI270749v1:140298-140320 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1190287306 X:48970187-48970209 GGGGCAGGGGTTGCTGGGCCAGG + Exonic
1190335356 X:49258473-49258495 GGCCGAGGGCTTGCCAGGCCTGG + Exonic
1191690353 X:63932836-63932858 GCTCCAGGGGTTGTCTGGCCTGG + Intergenic
1201191212 Y:11442663-11442685 AGTCCAGGAGTTGACCAGCCTGG + Intergenic