ID: 1006022313

View in Genome Browser
Species Human (GRCh38)
Location 6:31124602-31124624
Sequence GAGGCTCCCTAAACCCTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006022308_1006022313 19 Left 1006022308 6:31124560-31124582 CCATGCTATAAATGAATGGCAGA 0: 1
1: 2
2: 2
3: 18
4: 175
Right 1006022313 6:31124602-31124624 GAGGCTCCCTAAACCCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006022313 Original CRISPR GAGGCTCCCTAAACCCTGTA AGG Intronic
No off target data available for this crispr