ID: 1006024203 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:31137106-31137128 |
| Sequence | ATGCCCAGGCTGGAGTGCAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 568272 | |||
| Summary | {0: 227, 1: 38605, 2: 113477, 3: 184493, 4: 231470} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1006024203_1006024209 | 30 | Left | 1006024203 | 6:31137106-31137128 | CCATTGCACTCCAGCCTGGGCAT | 0: 227 1: 38605 2: 113477 3: 184493 4: 231470 |
||
| Right | 1006024209 | 6:31137159-31137181 | AGAAAAAGAAGAAAGAGGCCGGG | 0: 1 1: 8 2: 140 3: 1117 4: 7333 |
||||
| 1006024203_1006024207 | 25 | Left | 1006024203 | 6:31137106-31137128 | CCATTGCACTCCAGCCTGGGCAT | 0: 227 1: 38605 2: 113477 3: 184493 4: 231470 |
||
| Right | 1006024207 | 6:31137154-31137176 | AAGAAAGAAAAAGAAGAAAGAGG | 0: 3 1: 37 2: 416 3: 2558 4: 17623 |
||||
| 1006024203_1006024208 | 29 | Left | 1006024203 | 6:31137106-31137128 | CCATTGCACTCCAGCCTGGGCAT | 0: 227 1: 38605 2: 113477 3: 184493 4: 231470 |
||
| Right | 1006024208 | 6:31137158-31137180 | AAGAAAAAGAAGAAAGAGGCCGG | 0: 1 1: 7 2: 104 3: 1319 4: 9000 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1006024203 | Original CRISPR | ATGCCCAGGCTGGAGTGCAA TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||