ID: 1006024203

View in Genome Browser
Species Human (GRCh38)
Location 6:31137106-31137128
Sequence ATGCCCAGGCTGGAGTGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568272
Summary {0: 227, 1: 38605, 2: 113477, 3: 184493, 4: 231470}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006024203_1006024209 30 Left 1006024203 6:31137106-31137128 CCATTGCACTCCAGCCTGGGCAT 0: 227
1: 38605
2: 113477
3: 184493
4: 231470
Right 1006024209 6:31137159-31137181 AGAAAAAGAAGAAAGAGGCCGGG 0: 1
1: 8
2: 140
3: 1117
4: 7333
1006024203_1006024207 25 Left 1006024203 6:31137106-31137128 CCATTGCACTCCAGCCTGGGCAT 0: 227
1: 38605
2: 113477
3: 184493
4: 231470
Right 1006024207 6:31137154-31137176 AAGAAAGAAAAAGAAGAAAGAGG 0: 3
1: 37
2: 416
3: 2558
4: 17623
1006024203_1006024208 29 Left 1006024203 6:31137106-31137128 CCATTGCACTCCAGCCTGGGCAT 0: 227
1: 38605
2: 113477
3: 184493
4: 231470
Right 1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG 0: 1
1: 7
2: 104
3: 1319
4: 9000

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006024203 Original CRISPR ATGCCCAGGCTGGAGTGCAA TGG (reversed) Intronic
Too many off-targets to display for this crispr