ID: 1006024205

View in Genome Browser
Species Human (GRCh38)
Location 6:31137120-31137142
Sequence CGGAGTCTCACTCTATGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13246
Summary {0: 3, 1: 27, 2: 266, 3: 2673, 4: 10277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006024205_1006024208 15 Left 1006024205 6:31137120-31137142 CCTGGGCATAGAGTGAGACTCCG 0: 3
1: 27
2: 266
3: 2673
4: 10277
Right 1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG 0: 1
1: 7
2: 104
3: 1319
4: 9000
1006024205_1006024207 11 Left 1006024205 6:31137120-31137142 CCTGGGCATAGAGTGAGACTCCG 0: 3
1: 27
2: 266
3: 2673
4: 10277
Right 1006024207 6:31137154-31137176 AAGAAAGAAAAAGAAGAAAGAGG 0: 3
1: 37
2: 416
3: 2558
4: 17623
1006024205_1006024210 24 Left 1006024205 6:31137120-31137142 CCTGGGCATAGAGTGAGACTCCG 0: 3
1: 27
2: 266
3: 2673
4: 10277
Right 1006024210 6:31137167-31137189 AAGAAAGAGGCCGGGCGCTGTGG 0: 2
1: 40
2: 377
3: 2745
4: 10929
1006024205_1006024209 16 Left 1006024205 6:31137120-31137142 CCTGGGCATAGAGTGAGACTCCG 0: 3
1: 27
2: 266
3: 2673
4: 10277
Right 1006024209 6:31137159-31137181 AGAAAAAGAAGAAAGAGGCCGGG 0: 1
1: 8
2: 140
3: 1117
4: 7333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006024205 Original CRISPR CGGAGTCTCACTCTATGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr