ID: 1006024206

View in Genome Browser
Species Human (GRCh38)
Location 6:31137140-31137162
Sequence TTCTTTCTTTTTTTTTTAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206083
Summary {0: 33, 1: 664, 2: 8439, 3: 103037, 4: 93910}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006024206_1006024208 -5 Left 1006024206 6:31137140-31137162 CCGTCTAAAAAAAAAAGAAAGAA 0: 33
1: 664
2: 8439
3: 103037
4: 93910
Right 1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG 0: 1
1: 7
2: 104
3: 1319
4: 9000
1006024206_1006024207 -9 Left 1006024206 6:31137140-31137162 CCGTCTAAAAAAAAAAGAAAGAA 0: 33
1: 664
2: 8439
3: 103037
4: 93910
Right 1006024207 6:31137154-31137176 AAGAAAGAAAAAGAAGAAAGAGG 0: 3
1: 37
2: 416
3: 2558
4: 17623
1006024206_1006024210 4 Left 1006024206 6:31137140-31137162 CCGTCTAAAAAAAAAAGAAAGAA 0: 33
1: 664
2: 8439
3: 103037
4: 93910
Right 1006024210 6:31137167-31137189 AAGAAAGAGGCCGGGCGCTGTGG 0: 2
1: 40
2: 377
3: 2745
4: 10929
1006024206_1006024209 -4 Left 1006024206 6:31137140-31137162 CCGTCTAAAAAAAAAAGAAAGAA 0: 33
1: 664
2: 8439
3: 103037
4: 93910
Right 1006024209 6:31137159-31137181 AGAAAAAGAAGAAAGAGGCCGGG 0: 1
1: 8
2: 140
3: 1117
4: 7333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006024206 Original CRISPR TTCTTTCTTTTTTTTTTAGA CGG (reversed) Intronic
Too many off-targets to display for this crispr