ID: 1006024208

View in Genome Browser
Species Human (GRCh38)
Location 6:31137158-31137180
Sequence AAGAAAAAGAAGAAAGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10431
Summary {0: 1, 1: 7, 2: 104, 3: 1319, 4: 9000}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006024203_1006024208 29 Left 1006024203 6:31137106-31137128 CCATTGCACTCCAGCCTGGGCAT 0: 227
1: 38605
2: 113477
3: 184493
4: 231470
Right 1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG 0: 1
1: 7
2: 104
3: 1319
4: 9000
1006024206_1006024208 -5 Left 1006024206 6:31137140-31137162 CCGTCTAAAAAAAAAAGAAAGAA 0: 33
1: 664
2: 8439
3: 103037
4: 93910
Right 1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG 0: 1
1: 7
2: 104
3: 1319
4: 9000
1006024204_1006024208 19 Left 1006024204 6:31137116-31137138 CCAGCCTGGGCATAGAGTGAGAC 0: 9
1: 140
2: 838
3: 7218
4: 13193
Right 1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG 0: 1
1: 7
2: 104
3: 1319
4: 9000
1006024205_1006024208 15 Left 1006024205 6:31137120-31137142 CCTGGGCATAGAGTGAGACTCCG 0: 3
1: 27
2: 266
3: 2673
4: 10277
Right 1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG 0: 1
1: 7
2: 104
3: 1319
4: 9000

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006024208 Original CRISPR AAGAAAAAGAAGAAAGAGGC CGG Intronic
Too many off-targets to display for this crispr