ID: 1006030179

View in Genome Browser
Species Human (GRCh38)
Location 6:31172117-31172139
Sequence CTGTGTGAGGGGATTGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006030179_1006030185 2 Left 1006030179 6:31172117-31172139 CCAGTCCCAATCCCCTCACACAG 0: 1
1: 0
2: 0
3: 28
4: 293
Right 1006030185 6:31172142-31172164 TCCCCTTCAGAGACGCTAAAAGG 0: 1
1: 0
2: 1
3: 5
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006030179 Original CRISPR CTGTGTGAGGGGATTGGGAC TGG (reversed) Intronic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
902616877 1:17628619-17628641 CTGTGTGAGGTCATAGGGAGAGG + Intronic
902839899 1:19068077-19068099 CTGAGTCAGGGGGCTGGGACAGG - Intergenic
902973512 1:20072148-20072170 GTGTGTTTGGGGATGGGGACGGG - Intronic
903137394 1:21318417-21318439 CTTTGTTAAGGGAGTGGGACAGG - Intronic
903171577 1:21557885-21557907 CTTTGGGAGGGGGTTGGCACAGG - Intronic
903290648 1:22312001-22312023 TTGTGGGAGGAGATTGAGACAGG + Intergenic
904163177 1:28536191-28536213 CTGTGGGAGGAGATTGAGAAGGG + Intronic
908797136 1:67841708-67841730 CTGTGTGTAGGGGTTGGGGCAGG + Intergenic
909223395 1:72989524-72989546 CTGTGTGTGGCGATTAGGCCTGG + Intergenic
911090788 1:94015423-94015445 CTGGGTGAGGGGTTGGGGAATGG + Intronic
912459787 1:109822944-109822966 CTGTGAGAGGAGAATGGGAAAGG + Intergenic
912507064 1:110163674-110163696 CTGTGTGTGAGGACTGGGGCAGG - Intronic
915247843 1:154568674-154568696 CTCTCTGAGGGGATGGGGAGGGG + Intronic
915534611 1:156527755-156527777 CTGTGTCAGGGCATGGGGAAAGG + Intronic
915593034 1:156881375-156881397 CTCAGTGAGGGCACTGGGACTGG + Intronic
915889116 1:159754729-159754751 CTCTGTGAGGATACTGGGACCGG - Intergenic
916313995 1:163427387-163427409 GTGTGGGAGGGGCTGGGGACAGG + Intergenic
917451588 1:175151803-175151825 GTGTGTGAGGAGATGTGGACAGG + Intergenic
918339441 1:183555911-183555933 GTGGGTGAGGAGATGGGGACAGG - Exonic
920097265 1:203494277-203494299 CTGGGGCAGGGGATTGGGAAGGG + Intronic
920957173 1:210630259-210630281 CTGTGTGAGGTGACTTTGACAGG + Intronic
921435052 1:215108832-215108854 GTGTGTGAGGGGTTGGGGAGAGG + Intronic
923520488 1:234731811-234731833 GTGTGTGAGGGCATTGGAACAGG + Intergenic
924243226 1:242059369-242059391 CTGGGTGGGGGGACTGGGTCTGG + Intergenic
924633254 1:245762235-245762257 CTGTGTGAGGTCAATGGGACAGG - Intronic
1062764033 10:47955-47977 CTGGGTGGGGGGACTGGGTCTGG - Exonic
1064228388 10:13507321-13507343 CTGAGTGATGGGTTTGAGACTGG - Intronic
1067073988 10:43162362-43162384 TTGGGTGGGGGTATTGGGACTGG + Intronic
1067207971 10:44235764-44235786 CTCTGTGAGGGGATAGGGCTGGG + Intergenic
1068710683 10:60130202-60130224 CTGGGGGAGGGGAGTGGGAGAGG - Intronic
1068735444 10:60408831-60408853 CTGGCTGAGGGGTTTGGGAGGGG - Intronic
1069385988 10:67884148-67884170 CGGTGTGAGGAGAGTGGGAAAGG + Intergenic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070741583 10:78907048-78907070 CTGTGTGGAGGGAAGGGGACAGG - Intergenic
1071559266 10:86632533-86632555 GTGTGTGGGGGGATGGGGAATGG - Intergenic
1072751034 10:97979004-97979026 CTGAGTGAGGAGATGGGGGCAGG + Intronic
1073042057 10:100614533-100614555 CTGTGTGAGGGTATTGTTATAGG + Intergenic
1074890115 10:117728848-117728870 ATGTGTGAGTGGGTTGGGAGTGG + Intergenic
1075420865 10:122299293-122299315 CTGTGTGTGGGGCTGGGGAGAGG + Intronic
1077006534 11:360497-360519 CTGTGTGACGGCATTTGGAGGGG - Intergenic
1078058896 11:8031203-8031225 CTGTGTGAACGGGGTGGGACTGG + Intronic
1080728070 11:34916852-34916874 CTGAGTGATGGGCCTGGGACAGG + Intronic
1080940264 11:36909222-36909244 CTGTGTGAGGTGAGTTGGAAGGG + Intergenic
1083776169 11:64895238-64895260 CTGTGTGAGGAGATGGGCATGGG + Intronic
1083954500 11:65976105-65976127 GTGTGTGAGGGGCTTTGGAGGGG + Intronic
1084935703 11:72585505-72585527 CTGTGTGTGGGCATGGGGGCTGG - Intronic
1085053505 11:73391492-73391514 CTCTTTGAAGGGATGGGGACAGG - Intronic
1085399860 11:76229538-76229560 CTCTCTGTGGGGACTGGGACAGG - Intergenic
1085427100 11:76414335-76414357 CTGCTTGGGGGGATTGGAACTGG - Intronic
1085769214 11:79310072-79310094 CTGCGTCAGGGGTTTGGGAGTGG - Intronic
1085991742 11:81856177-81856199 CTGTGTGTGGGAATGGGAACAGG - Intergenic
1086041685 11:82486906-82486928 GAGTCTGAGGGGATTGGCACAGG - Intergenic
1086433926 11:86763097-86763119 CTGTGTGAGGGAGTGGGGGCAGG + Intergenic
1088884276 11:113994763-113994785 GTGTGTGATGGGGTGGGGACTGG - Intergenic
1089188544 11:116637434-116637456 CTGTGTGATGGGGGTGGGATGGG - Intergenic
1090472569 11:126993298-126993320 CTGTGTTAGGGAAGTGGGAGAGG - Intronic
1091247708 11:134112939-134112961 CTGTGTGATGGGCTAGGGCCTGG + Intronic
1092857192 12:12685222-12685244 ATGGGTGATGGGATGGGGACAGG - Intronic
1095477565 12:42601327-42601349 CCATGTGAGGGGATGGGAACAGG + Intergenic
1095746720 12:45667426-45667448 TGGGGTGAGGGGATTGGGACAGG - Intergenic
1095958297 12:47819044-47819066 CTGTGTGAGGGGTGGGGGACAGG - Intronic
1097285253 12:57872263-57872285 CTGAATGAGGGGATAGGGATTGG - Intergenic
1101139918 12:101784616-101784638 CTGTGTGAGGGAATTCAGTCTGG + Intronic
1102200937 12:111057297-111057319 CTGTGTGAGGGCAATGGGTGTGG + Intronic
1103990678 12:124797323-124797345 CTGGGGGAGGGCATGGGGACGGG - Intronic
1105387383 13:19943949-19943971 CTGTTTGAGGGGAATGAGAAGGG + Intergenic
1106411890 13:29516389-29516411 CTGTGTGTGGGGTGTGGGAGTGG - Intronic
1106526493 13:30545300-30545322 CTGTGTGAGGGTGTTGTCACTGG + Intronic
1106620052 13:31364326-31364348 CTGTGTGAGAGGAGGGGGTCAGG - Intergenic
1106621419 13:31374399-31374421 CTCTGTGAGGGGAATGGAGCAGG - Intergenic
1108147473 13:47494754-47494776 CTGTGTGAGGAGAATGAAACAGG + Intergenic
1108972541 13:56394967-56394989 CTGGGGGAGGGGAGTGGGATGGG + Intergenic
1109039504 13:57314692-57314714 CTGCGAGATGGGATTGGGCCAGG - Intergenic
1109061934 13:57631604-57631626 CTGTGTGAGTCTATTGGGAGGGG - Intergenic
1113423570 13:110188896-110188918 CTGCTTGATGGGATTGGGCCAGG - Intronic
1113632378 13:111897093-111897115 CTTTGGGAGGGGATTAGGTCAGG + Intergenic
1114183056 14:20381502-20381524 CTGAGTGTGGGGCTTGGGCCTGG - Intronic
1114996863 14:28365105-28365127 CTGTGATAGGGGAGTGGGGCAGG + Intergenic
1116000345 14:39236664-39236686 CTGTGTGAAGGGATAGGAAGAGG + Intronic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1117866279 14:60152849-60152871 CTGTGTGAGGTCCTTGGAACTGG - Intronic
1118430062 14:65708848-65708870 GTGTGGGAGGGGATGGGGAAAGG + Intronic
1121642805 14:95497141-95497163 CTGTGTGGGGGGACAGGGGCTGG - Intergenic
1122570251 14:102693559-102693581 CTGTGAGAGGGAGTTGGGAGGGG - Intronic
1122776299 14:104118353-104118375 CTGGGTGAGGAGGTGGGGACTGG - Intergenic
1124087005 15:26560422-26560444 TTGGGTGAGGGCATTTGGACTGG - Intronic
1124252601 15:28116877-28116899 CTGTGTGAGGGGACTTCGAGTGG - Intronic
1124425481 15:29559294-29559316 CTGTGTGAGGTGAGGGGAACAGG - Intronic
1124561960 15:30782459-30782481 CTGGGTGCTGGGATTGGAACAGG + Intergenic
1125686719 15:41567944-41567966 CTGTGAGAGGGGAGTGGTAAGGG + Intronic
1126348675 15:47722064-47722086 CTGGATGAGGGGCCTGGGACAGG - Intronic
1127281911 15:57500094-57500116 CTGGGTGTGGGGAGTGGGAATGG + Intronic
1129696874 15:77745661-77745683 GTGTATGAGGTGATTGGCACAGG - Intronic
1130427374 15:83814776-83814798 TTGGGAGAGGGGATTGGGAGGGG + Intronic
1131067117 15:89441588-89441610 CTGTGGGTGGGGCTTGGGAGAGG + Intergenic
1131361044 15:91790947-91790969 CTGTGTGGGGGAATTGGCACGGG - Intergenic
1132057364 15:98662445-98662467 CTGTGGAAGGGGAGTGGGAGTGG + Intronic
1132138317 15:99366708-99366730 CAGTGTGAGGGCATTTGGAGAGG - Intronic
1132204233 15:99975590-99975612 CTGTGTGAGTGGTTTGGCCCTGG - Intronic
1133109151 16:3535318-3535340 TTGTGTGAGGGGAGAGAGACAGG + Intronic
1135424418 16:22325267-22325289 GTGTGTGAGGGGCTTTGGGCTGG + Intronic
1135932416 16:26749669-26749691 CTGTGTGAGGGGCTGGAGAAGGG - Intergenic
1138374203 16:56551549-56551571 GTGGGGGAGGGGATTGGGGCAGG - Intergenic
1138514699 16:57529512-57529534 CTGGGTGAAGGGATTGGAGCAGG - Intronic
1138562489 16:57810209-57810231 CTGGGTGGGGAGATGGGGACAGG + Intronic
1139296733 16:65907832-65907854 CTGGGGGAGGGGTTTGGGAGTGG - Intergenic
1139307819 16:66002740-66002762 CTGTGTTAGTGGCTTGGAACTGG - Intergenic
1141303264 16:82837602-82837624 CTGTGTGACTGCATTGGGAGGGG - Intronic
1142440619 16:90095271-90095293 CTGGGTGGGGGGACTGGGTCTGG + Intergenic
1142878857 17:2869099-2869121 CTTTGGGAGGTGATTGGGTCAGG - Intronic
1143324574 17:6090437-6090459 CTGTGTGCGGGGCTGTGGACCGG + Exonic
1143537463 17:7549695-7549717 CTGTGTGAGGGGTTTGTGCTGGG + Intronic
1144644053 17:16957089-16957111 CTGTGCGGGGGGATGTGGACAGG + Intronic
1146053275 17:29568568-29568590 CTGTGGGCGGGCATTGGGGCGGG + Intronic
1146329652 17:31917084-31917106 GTGTGGTAGGGGACTGGGACAGG + Intergenic
1146416457 17:32637761-32637783 GTGTGTGAGGGGGTTGGGTGAGG + Intronic
1147600115 17:41740098-41740120 CTGTGGGAGAGGATGGAGACCGG + Intergenic
1148325135 17:46779038-46779060 GTGTGTGATGGGGTAGGGACCGG - Intronic
1149317991 17:55456993-55457015 CTGTGTGAGAGGATTGCGAATGG + Intergenic
1149923203 17:60677972-60677994 CGGCGTGAGGGGACTGGGTCGGG + Intronic
1152723033 17:81932096-81932118 CTGTGTGAGGGGAGCTGGGCTGG - Intergenic
1152762135 17:82114336-82114358 CTGGGTGAGGGGGGAGGGACGGG + Intronic
1152956941 18:48288-48310 CTGGGTGGGGGGACTGGGTCTGG - Exonic
1153835918 18:8963657-8963679 CTGTGTGTGTGGGTGGGGACGGG - Intergenic
1154931656 18:21003609-21003631 CAGTGTCAGAGGATTGGGAAGGG + Intronic
1155032526 18:21996931-21996953 CTGTGACAGGTGATTGGGAAAGG + Intergenic
1155356403 18:24957932-24957954 CTGTGGGAGGTGATTGGTCCTGG + Intergenic
1157769514 18:50333587-50333609 CTCTGTCAGGGGGTTGGGACGGG - Intergenic
1159557621 18:69961878-69961900 CTTTGTCAGGGAACTGGGACTGG - Intergenic
1160092224 18:75838287-75838309 CTGAGTCAGTGGATTGGGAGAGG + Intergenic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160876948 19:1300804-1300826 CCGTGTGAGGCGAGGGGGACGGG - Intergenic
1162478401 19:10914345-10914367 CTGGGAGTGGGGATTGGGACAGG + Intronic
1164720750 19:30430045-30430067 GTGGGGGAGGGGATTGGGAGTGG + Intronic
1166773474 19:45298283-45298305 GTGTGTGCGGGCATTGGGAGGGG + Intronic
1167620469 19:50557322-50557344 CTGTGAGTGGAGATTGGGGCTGG - Intronic
1167991428 19:53364571-53364593 CTTTGTGAGGGGAGTGTGGCAGG - Intergenic
1168419805 19:56194152-56194174 CTGGGGGAGGGGGTTGGGGCAGG - Intronic
1168510372 19:56968907-56968929 CTGTCTCAGGGAACTGGGACTGG - Intergenic
925527341 2:4817554-4817576 CTGTCTGAGGGGATTAGGAAAGG + Intergenic
925722520 2:6842806-6842828 CTGTTTGAGGGTTTTGGGAAGGG + Intronic
926353923 2:12022507-12022529 CTCTTTGAGGGAATTGGGAGAGG - Intergenic
926798483 2:16638390-16638412 CTGTGTGATGGGATCTGGCCGGG + Intronic
927273427 2:21239186-21239208 CTGTGTAAGGGAATTGAGAAGGG + Intergenic
931450412 2:62363476-62363498 CTGTGTGAGGGGAGTTGGAGGGG - Intergenic
932143287 2:69297907-69297929 CTGTGCAAGGGGATTGGGAGAGG + Intergenic
935156095 2:100484883-100484905 CTGAGGGATGGGATTGGGATAGG + Intergenic
935684157 2:105668920-105668942 CTGTGTGAGCTGATTGTTACGGG + Intergenic
935804014 2:106728925-106728947 CTGTGTCAGGGGATTTAGAGAGG - Intergenic
935804465 2:106732202-106732224 TGGTGTGAGGGGATTGTGAGGGG + Intergenic
936918844 2:117667393-117667415 CTCTGAGGGAGGATTGGGACTGG + Intergenic
937032256 2:118750466-118750488 CTGTTGGAGGGGATTGGGGGAGG - Intergenic
937342309 2:121099057-121099079 CTGGGAGAGGGGCTGGGGACAGG + Intergenic
940280909 2:151988767-151988789 CTTTGGGAGGTGATTGGGCCAGG - Intronic
941414697 2:165205563-165205585 CTGTGTGAGGCGCCTGGGGCAGG - Intergenic
943670933 2:190659578-190659600 CTGTGTGCAGAGCTTGGGACAGG + Exonic
946161170 2:217836933-217836955 CTGTGGAATGGGATTGGGATGGG - Intronic
946534858 2:220615924-220615946 CTGTATGAGGGGAATGAGACTGG - Intergenic
947232512 2:227902424-227902446 CTGGGGGAGGGGAGTGGGAAGGG + Intronic
947454511 2:230241593-230241615 CTGTGTGAGGGGAGGAGGACTGG - Intronic
1170411424 20:16096272-16096294 CAGTGTTGGGGGATTGGGAGGGG + Intergenic
1172113347 20:32560159-32560181 CTGTGTGACGGGGCTGGGAGAGG - Intronic
1172198092 20:33105789-33105811 CTCTGTGAGAGGATGGGGTCAGG + Intronic
1172939843 20:38646492-38646514 GGGTGTGAGGTGATTGGGGCTGG + Intronic
1172977949 20:38920432-38920454 CTGGGCTAGGGGCTTGGGACTGG + Exonic
1172997606 20:39082812-39082834 GTGTGTGAGGGGATGTGGCCAGG + Intergenic
1173074994 20:39809699-39809721 CAGCGTGAGGGGATGGGGACAGG + Intergenic
1173285802 20:41670572-41670594 GTGTGTGAGGGGGGTGGGAGTGG + Intergenic
1173485558 20:43438553-43438575 GTGTGTGGGGGGATGGGGATGGG - Intergenic
1174701980 20:52618104-52618126 CTGAGTGGGGGGATTGGGGGCGG + Intergenic
1174764200 20:53236559-53236581 CTGTGAGAGGGCACTGGGTCTGG + Intronic
1175379023 20:58549916-58549938 CTGTTTCAGAGGATTGGGGCAGG - Intergenic
1175498470 20:59432070-59432092 CTGTGTCAGGGTGTTGGGATTGG + Intergenic
1176236510 20:64056140-64056162 CTGTGGGAGGGAGCTGGGACTGG + Intronic
1176239153 20:64067911-64067933 CTGGGTGAGGGGCTGGGGGCGGG + Intronic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1179993539 21:44961128-44961150 CTGTGAAAGTGGATTTGGACGGG + Intronic
1180002722 21:45002367-45002389 TTGGGTGAGGGGCTTGGGAGGGG + Intergenic
1180873458 22:19161807-19161829 CTGTGGGATGGAATTGGGCCAGG + Intergenic
1180875774 22:19174642-19174664 CTGTGTGAGGTCACTAGGACAGG + Intergenic
1181690612 22:24557308-24557330 GTGTGTCAGGGGAGGGGGACTGG - Intronic
1183284090 22:36951858-36951880 ATCTGTGAGGGGGTTGGGGCAGG + Intergenic
1183306062 22:37083831-37083853 CTGTGCAATGGGATTGGGCCTGG + Intronic
1183503335 22:38194402-38194424 CAGAGGGAGGGGATGGGGACTGG + Intronic
1183564964 22:38607710-38607732 TTGAGTGAGAGAATTGGGACTGG - Intronic
1183575196 22:38683615-38683637 GTGTGGGTGGGGATTGGGATCGG + Intronic
1184270422 22:43378365-43378387 CTGTGTGAGGTGCAAGGGACAGG + Intergenic
951651999 3:24960964-24960986 CTGTGAGAGGGGCCTGTGACAGG + Intergenic
952990212 3:38824877-38824899 CTGTCTCAGGGGTTTGGGATGGG - Intergenic
953843186 3:46406421-46406443 CTGTGGGAAGAGAGTGGGACGGG - Intergenic
953977822 3:47395593-47395615 CTGTGTGAGGAGAATGGCCCAGG - Intronic
954948166 3:54444963-54444985 CTGTTTAAGGGGGTTGGGAGAGG - Intronic
955202318 3:56862160-56862182 CAGGGTGAGGGGAGTGGGAGGGG + Intronic
955587440 3:60496179-60496201 ATGTGTGATGGGGTCGGGACAGG - Intronic
955782076 3:62495379-62495401 CTGTGTGACCGGGTTGGGAAAGG + Intronic
959391939 3:105786047-105786069 CTGTGTGAGAGGATCGGGGGGGG + Intronic
960718937 3:120606268-120606290 CTGTGTGATGGAATTGGGAGTGG - Intergenic
961043279 3:123692468-123692490 CTGGGTGTGGGGATCAGGACTGG + Intronic
961231751 3:125318996-125319018 GTGTGTGGGGGGGTTGGGAGTGG - Intronic
961378690 3:126483259-126483281 CTGGGTGTGGGGATGGGGGCCGG - Intronic
961648598 3:128406005-128406027 CTGTGAGAGTGGCATGGGACAGG - Intronic
961915569 3:130370413-130370435 CTGGAAGAGGGGATTGGGAGTGG + Intronic
963240937 3:143001745-143001767 CTGTGAGAGGCGATTGGGATTGG + Intronic
963851734 3:150216479-150216501 ATGTGGGAGGGGCTTGGGGCAGG + Intergenic
964197515 3:154081814-154081836 AAGAGTGAGGGGAGTGGGACAGG - Intergenic
964392399 3:156211538-156211560 CTGTGTGTGGGCATTGGCATAGG - Intronic
965282099 3:166766867-166766889 CTGTGAGATGGGATTAGGCCAGG + Intergenic
965523837 3:169696247-169696269 CTGTGGGAGGGGATTATGAATGG - Intergenic
966271387 3:178111117-178111139 CAGTGTAAGGGAATTGGGAGAGG + Intergenic
967135693 3:186510833-186510855 CCGTGTGAGGGGAGTGGTACGGG - Intergenic
967298064 3:187985020-187985042 CTGGGGTAGGGGATAGGGACAGG - Intergenic
968357371 3:198119859-198119881 CTGGGTGGGGGGACTGGGTCTGG + Intergenic
968782187 4:2591424-2591446 CAGTGTGAGGGGGTTTTGACAGG + Intronic
969177813 4:5412553-5412575 CTGTAGGAGGAGAGTGGGACGGG + Intronic
969624943 4:8297625-8297647 CTGTGGGAAGGGAGTGGGGCAGG + Intronic
975718362 4:77227284-77227306 CTGTGGGAGGGGATAGGGGGTGG + Intronic
979573534 4:122258547-122258569 CTGAGTGAGAGGATTGGGGTGGG + Intronic
980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG + Intergenic
983076328 4:163331721-163331743 CTGGGTTAGGAGATTGGGAATGG - Intronic
983153934 4:164320792-164320814 GTGTGTGGGGGGAGTGGGGCTGG + Intronic
983586073 4:169356147-169356169 CTGTGGGAGGGGGTTGGGTGGGG + Intergenic
984955080 4:185037075-185037097 CGTGGTGAGGGGAGTGGGACGGG - Intergenic
985441164 4:189983391-189983413 CTGGGTGGGGGGACTGGGTCTGG - Intergenic
986249336 5:6042510-6042532 CTGTGGGTGGGGAGAGGGACAGG + Intergenic
986268366 5:6210161-6210183 CTTTGGGAGGTGATTGGGTCAGG - Intergenic
986286818 5:6365295-6365317 CTCTGTGAGTGGAATGGGTCTGG + Intergenic
986445680 5:7819196-7819218 TTGAGTGAGTGGATTGGGAAAGG - Intronic
987891276 5:23881644-23881666 CTGTGGGAGGTGATTGGATCAGG + Intergenic
988798324 5:34673306-34673328 CTGTGTGAGGGCAATGGGGCAGG + Intronic
989119108 5:37985770-37985792 CTGTCTGTGCTGATTGGGACTGG - Intergenic
990928681 5:61060945-61060967 CTGTGTGAATGGATTAGGAAAGG + Intronic
993384700 5:87251061-87251083 CTGTGTGGGGGGATGGGGGGTGG - Intergenic
993889410 5:93455147-93455169 CTGTGTGTGGGGATTGTCACAGG - Intergenic
997521782 5:134527744-134527766 GTGGCTGAGGGGATTGGGAGGGG - Intronic
998468846 5:142367354-142367376 GGGAGTGAGGGAATTGGGACTGG + Intergenic
999315772 5:150582850-150582872 CTGAGTGAGTGGTTTGGGAGAGG + Intergenic
999872404 5:155766033-155766055 CAGGGTGAGGGGACTTGGACTGG + Intergenic
1001210781 5:169808312-169808334 GTGTGTTTGGGGAATGGGACAGG + Intronic
1001233035 5:170006170-170006192 CAGTCTGAGGGGATGTGGACAGG + Intronic
1001966493 5:175913550-175913572 CAGTGTGAGGGTATTAGGAAGGG - Intergenic
1002250454 5:177925654-177925676 CAGTGTGAGGGTATTAGGAAGGG + Intergenic
1002282944 5:178143835-178143857 CTGTGTGAGGCTCTTGAGACAGG - Intronic
1002569979 5:180134726-180134748 CTGGGTGAAGAGATGGGGACAGG - Intronic
1005493589 6:26369468-26369490 TTGTGTTAGGGGATTGGGGCCGG + Intronic
1006030179 6:31172117-31172139 CTGTGTGAGGGGATTGGGACTGG - Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1007077654 6:39078225-39078247 AAGTGTGAGGGGCTTGGGGCAGG + Intronic
1008666699 6:53723871-53723893 TTGTGTGAGGGCAGTGGGAGGGG - Intergenic
1009787912 6:68362278-68362300 GTGTGTCAGGGGATGGGGGCAGG + Intergenic
1010892750 6:81334546-81334568 ATGGGTGGGGCGATTGGGACTGG + Intergenic
1011180958 6:84620181-84620203 ATGGGGGAGGGGATGGGGACAGG - Intergenic
1011763969 6:90599023-90599045 CTGAGTGAGGGGCTGGAGACTGG + Intergenic
1013144041 6:107369677-107369699 CTGTGTATGGAGATTGGTACTGG - Intronic
1015872608 6:137792374-137792396 CTGGGTGGGAGGGTTGGGACGGG + Intergenic
1018346600 6:162905292-162905314 CTGTGTGAATGGAGTGGGAAGGG + Intronic
1019363664 7:619229-619251 CTGTGTGTGGGGATCTGGCCTGG - Intronic
1019811340 7:3167374-3167396 CTGTGTGTGGGGATGGGGATGGG - Intronic
1019863582 7:3683924-3683946 CTGTGTGGCTGCATTGGGACAGG - Intronic
1020244549 7:6420607-6420629 TTGTGTTAGGGGTGTGGGACTGG + Intronic
1022498182 7:30866219-30866241 CTGGGTGAGTGGATAGGGGCAGG - Intronic
1022844619 7:34197483-34197505 CTTTGGGAGGTGATTGGGAATGG + Intergenic
1022973899 7:35539738-35539760 CCCTGTGAGGGGGTTGGGGCAGG + Intergenic
1023188943 7:37558664-37558686 CAGAGTGAGGAGATTGGGAAGGG + Intergenic
1024039826 7:45543651-45543673 GTGTGTGTGTGGATTGGGTCAGG + Intergenic
1024380839 7:48694723-48694745 CAGTGTGAGGGAATGGGGAAGGG + Intergenic
1024893158 7:54226230-54226252 CTGTGTGGGTGGATTGGGAGGGG + Intergenic
1024900760 7:54316157-54316179 CTGTGTGGGTGGATTGGGAGGGG - Intergenic
1026045115 7:66901795-66901817 CTGCGAGAGAGGACTGGGACTGG - Intergenic
1026203720 7:68237414-68237436 CTGTGGTAGGGGATTTGGAAGGG - Intergenic
1029284137 7:99454535-99454557 CTGGGGGAGGGGATGGGGACAGG - Intronic
1029371637 7:100154565-100154587 CTGTCTCAGGGGTTGGGGACAGG - Exonic
1030197734 7:106868757-106868779 CTCTGTGAAGGGTTTGGGGCTGG - Exonic
1031785592 7:126027607-126027629 CTGTGTGAGGTGATTGGGTAAGG + Intergenic
1032463358 7:132127725-132127747 CTGGGGGAGGGGTTTGGGGCTGG - Exonic
1033530023 7:142252491-142252513 CTGTGTGTGGGCATTGTGCCAGG - Exonic
1034822530 7:154230161-154230183 CTGTGTGGGAGGATGGGGAGAGG - Intronic
1034841883 7:154405643-154405665 CAGTGTGAGGGGACTGGAGCTGG + Intronic
1035123519 7:156590273-156590295 CTGTGTGACGGCAGTGGGAGAGG - Intergenic
1035407614 7:158609832-158609854 GTGTGTGAGGGGAGTGTGAGGGG + Intergenic
1035649973 8:1256941-1256963 CTGTGTGAAAGGAATGGGGCAGG - Intergenic
1036141903 8:6216631-6216653 ATGTGTGGGGACATTGGGACTGG - Intergenic
1037130664 8:15404483-15404505 CTGAGTGATAGGATTGGGAGGGG - Intergenic
1038082473 8:24154722-24154744 TAGTATGAGGGGATTGGGGCAGG - Intergenic
1041406226 8:57502184-57502206 CTGTGTGTGGGGTTGGGGGCAGG + Intergenic
1042220512 8:66468592-66468614 TTCTGTGTGGGGTTTGGGACAGG - Exonic
1043495378 8:80795090-80795112 TTGTGTGAGGGCATTGGGATGGG - Intronic
1045737422 8:105313060-105313082 CTGTGGAAGAGGATTGGGAATGG + Intronic
1046986268 8:120391750-120391772 CTGTGTGGGTGGACTGGGAGGGG - Intronic
1047694607 8:127391098-127391120 GTGTGTCAGGGGAAAGGGACCGG + Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1051110351 9:13627988-13628010 CTGTTTGACTGGATTGGGCCTGG - Intergenic
1051613194 9:18981488-18981510 CTGTGTGAGGGGCTTTAGCCTGG - Intronic
1052817146 9:33110577-33110599 CTGTGGGATGGGGTGGGGACAGG - Intronic
1053683443 9:40499917-40499939 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1053933422 9:43128232-43128254 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054280272 9:63125011-63125033 GTGTGTGTGGGGGTGGGGACTGG + Intergenic
1054296546 9:63335415-63335437 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054394564 9:64639920-64639942 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054429213 9:65145119-65145141 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054501171 9:65876416-65876438 GTGTGTGTGGGGGTGGGGACTGG + Intergenic
1055621856 9:78134216-78134238 CTGTGTGAGTTTATGGGGACTGG - Intergenic
1057204430 9:93162882-93162904 CTGTGAGATGGGGTTGTGACTGG + Intergenic
1058259821 9:102814669-102814691 CTTGGTGTGGGGATTGGGAGGGG + Intergenic
1059184842 9:112258870-112258892 CTGGGTGAGGGCATAGGCACTGG - Intronic
1059332087 9:113542106-113542128 CTGTGTGTGGGGGTGGGGATGGG + Intronic
1059842035 9:118228420-118228442 GTGTGTGAGGGGACAGGGAATGG - Intergenic
1059921528 9:119165917-119165939 CTGTGTGTGGGGAACGGGAGTGG + Intronic
1060392195 9:123287226-123287248 TTGTGTGAGGGGATTTGCAGGGG + Intergenic
1062584439 9:137242633-137242655 CTGGGTGGGGGGACTGGGTCTGG + Exonic
1062622337 9:137428662-137428684 CCGGGTGGGGGGATTGGGAGAGG + Intronic
1062741225 9:138176344-138176366 CTGGGTGGGGGGACTGGGTCTGG + Intergenic
1187435429 X:19264158-19264180 GTGGGTGAGGGGAATGGGAGTGG - Intergenic
1188726077 X:33583816-33583838 CTGTGTGTGGGGGTGGGGAGGGG - Intergenic
1192177594 X:68895515-68895537 CAGTGGGAGGGGAGTGGGACAGG + Intergenic
1194084845 X:89513732-89513754 CTGTGTGTGGGGATAGGAACAGG - Intergenic
1194295635 X:92123121-92123143 CAGTGGGTGAGGATTGGGACAGG - Intronic
1195923829 X:110005792-110005814 CTGTGTGAGGCTGTCGGGACAGG + Intronic
1198754290 X:139967072-139967094 TAGGGTGAGGGGAGTGGGACAGG - Intergenic
1199694924 X:150337160-150337182 CTGTGAGAGGGGCTGGGGTCAGG - Intergenic
1199798548 X:151227245-151227267 CTGTGTGCAGAGCTTGGGACAGG - Intergenic
1200437494 Y:3169617-3169639 CTGTGTGTGGGGATAGGAATAGG - Intergenic