ID: 1006030193

View in Genome Browser
Species Human (GRCh38)
Location 6:31172179-31172201
Sequence GTCTTTGAGGGGATTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 380}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006030193_1006030200 0 Left 1006030193 6:31172179-31172201 CCCTCTGCAATCCCCTCAAAGAC 0: 1
1: 0
2: 1
3: 19
4: 380
Right 1006030200 6:31172202-31172224 TGAGCCTCAGACGGGCACCAAGG No data
1006030193_1006030201 1 Left 1006030193 6:31172179-31172201 CCCTCTGCAATCCCCTCAAAGAC 0: 1
1: 0
2: 1
3: 19
4: 380
Right 1006030201 6:31172203-31172225 GAGCCTCAGACGGGCACCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 87
1006030193_1006030206 20 Left 1006030193 6:31172179-31172201 CCCTCTGCAATCCCCTCAAAGAC 0: 1
1: 0
2: 1
3: 19
4: 380
Right 1006030206 6:31172222-31172244 AGGGCCCCCCACAGGGACCTAGG 0: 1
1: 0
2: 3
3: 33
4: 226
1006030193_1006030198 -9 Left 1006030193 6:31172179-31172201 CCCTCTGCAATCCCCTCAAAGAC 0: 1
1: 0
2: 1
3: 19
4: 380
Right 1006030198 6:31172193-31172215 CTCAAAGACTGAGCCTCAGACGG 0: 1
1: 0
2: 2
3: 20
4: 199
1006030193_1006030199 -8 Left 1006030193 6:31172179-31172201 CCCTCTGCAATCCCCTCAAAGAC 0: 1
1: 0
2: 1
3: 19
4: 380
Right 1006030199 6:31172194-31172216 TCAAAGACTGAGCCTCAGACGGG No data
1006030193_1006030204 13 Left 1006030193 6:31172179-31172201 CCCTCTGCAATCCCCTCAAAGAC 0: 1
1: 0
2: 1
3: 19
4: 380
Right 1006030204 6:31172215-31172237 GGCACCAAGGGCCCCCCACAGGG No data
1006030193_1006030203 12 Left 1006030193 6:31172179-31172201 CCCTCTGCAATCCCCTCAAAGAC 0: 1
1: 0
2: 1
3: 19
4: 380
Right 1006030203 6:31172214-31172236 GGGCACCAAGGGCCCCCCACAGG 0: 1
1: 0
2: 3
3: 23
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006030193 Original CRISPR GTCTTTGAGGGGATTGCAGA GGG (reversed) Intronic
900851086 1:5143641-5143663 GTCTTTGAGAGGCAGGCAGAAGG + Intergenic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
906454585 1:45982773-45982795 GTCTTTGTGGGGATGGCAGGGGG - Intronic
906637591 1:47419437-47419459 CTCTTTGAGGGGAGGGCAGTAGG + Intergenic
907920851 1:58910475-58910497 TGCTTTGAGGGCATTGGAGAGGG + Intergenic
910561391 1:88595898-88595920 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
910562202 1:88602394-88602416 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
913051449 1:115120128-115120150 CTCTATTAGGGCATTGCAGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915246819 1:154561463-154561485 GTCTTTGCAGGAATTGTAGAGGG + Intergenic
915772715 1:158445619-158445641 GTAGTTAAGGGGGTTGCAGATGG + Intergenic
915860573 1:159440165-159440187 GTATCTCAGGGGGTTGCAGATGG - Exonic
915874544 1:159598671-159598693 GTATCTCAAGGGATTGCAGATGG - Intergenic
917131266 1:171744270-171744292 GTTTTTGATGGGATAGCAAAGGG + Intergenic
918236292 1:182583535-182583557 GTCTGTGAGGGTGTTGCCGAAGG + Intronic
920687544 1:208120810-208120832 GTCTGTGAGGGGAGGTCAGAGGG + Intronic
921039753 1:211418473-211418495 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
921544009 1:216452763-216452785 GTCTGTGAGGGTGTTGCCGAAGG + Intergenic
922255118 1:223886970-223886992 CTCTGTGAGGGGGTTGCAGTGGG + Intergenic
922685867 1:227638510-227638532 CTCTTTAAGGGTAATGCAGACGG + Intronic
923839594 1:237654017-237654039 GTCTGTGAGGGGGTTGCCAAAGG - Intronic
1063228353 10:4038281-4038303 GGCTCTGAGGGGATTGAAAAAGG + Intergenic
1063273797 10:4541470-4541492 GTTTTGGAAGGGAATGCAGAAGG - Intergenic
1064519766 10:16188793-16188815 GTCTGTGAGGGTGTTGCCGAAGG + Intergenic
1064874509 10:19977685-19977707 CTCTTTCCGGGGTTTGCAGATGG + Intronic
1066229016 10:33413757-33413779 CTCTGTGGGGCGATTGCAGAGGG - Intergenic
1067562730 10:47315188-47315210 GTATTTGGGGGGAATCCAGAAGG - Intergenic
1068834218 10:61534414-61534436 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1071109547 10:82138972-82138994 GTCTTTGAGGGTGTTGCCAAAGG - Intronic
1071327806 10:84534295-84534317 CTCTGTGAGGGCAGTGCAGAAGG + Intergenic
1071338008 10:84617448-84617470 GACTTTGAGGGGATAAGAGATGG + Intergenic
1071783052 10:88868358-88868380 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1071804742 10:89105701-89105723 GTCTGTGAGGGTGTTGCAAAAGG - Intergenic
1072209755 10:93235661-93235683 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1072904253 10:99436749-99436771 GTCTTTCATGGGACTGCAGTTGG + Intergenic
1073795862 10:106987678-106987700 ATCTTTGAGGGCACTGGAGAGGG - Intronic
1073936505 10:108639120-108639142 CTCTTTGAGGGGATTCCAGAGGG - Intergenic
1073995573 10:109312335-109312357 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1074491469 10:113943138-113943160 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1074547588 10:114413305-114413327 GTCTGGGAGGGCATTCCAGAAGG - Intergenic
1074913071 10:117929421-117929443 GTCATTGAGGGCATTCCAAAAGG + Intergenic
1075606360 10:123814175-123814197 GTCTGTGAGGGTATTGCCAAAGG + Intronic
1076276183 10:129200628-129200650 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1077550836 11:3199571-3199593 GCCTTCGAGTGGATGGCAGAGGG + Intergenic
1077751331 11:4973483-4973505 GTATCTCAGGGGGTTGCAGATGG + Intronic
1077758200 11:5059226-5059248 ATATTGGAGTGGATTGCAGATGG + Exonic
1078460029 11:11507728-11507750 GTCTGTGAGGGCATTGCCAAAGG + Intronic
1081065903 11:38538513-38538535 GTCTTTGAGGGAGTTGCCAAAGG - Intergenic
1081691770 11:45083221-45083243 GTCGGAGAGGGGATGGCAGAAGG - Intergenic
1082108459 11:48245453-48245475 GTAGCTGAGGGGCTTGCAGATGG - Exonic
1082309058 11:50623102-50623124 GTTTTTGAAGGGTTTGCAAAGGG - Intergenic
1082836127 11:57651515-57651537 GTCTGTGAGGGTATTGCCAAAGG + Intronic
1084820326 11:71684559-71684581 GTCTACTAGGGCATTGCAGAAGG + Intergenic
1085236331 11:75018337-75018359 GTCTGTGAGGGTGTTGCCGAAGG + Intronic
1085937830 11:81171264-81171286 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1086054878 11:82634923-82634945 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1086834415 11:91602818-91602840 GTCTCTGAGGGTGTTGCTGAAGG + Intergenic
1086834435 11:91602969-91602991 GTCTCTGAGGGTGTTGCTGAAGG + Intergenic
1087094940 11:94309015-94309037 GCCTGTGAGGCGAGTGCAGAAGG - Intergenic
1087761576 11:102109412-102109434 GTTTTTGAGTGGCTTCCAGAAGG + Intergenic
1088796306 11:113269260-113269282 GACCCTGGGGGGATTGCAGATGG + Intronic
1088834128 11:113562980-113563002 GTCTTTCAGGAGATGGCAGGAGG - Intergenic
1089880487 11:121768693-121768715 GTCTGTGAGGGGGTTGCCAAAGG - Intergenic
1090097213 11:123754129-123754151 GTGGTGAAGGGGATTGCAGATGG + Exonic
1090829793 11:130413285-130413307 GTTATTGAGGGGAGAGCAGAGGG - Intronic
1092071647 12:5636343-5636365 CTCTTAGAGGGGATAGAAGAAGG + Intronic
1093646012 12:21586074-21586096 GTCTGTGAGGGTATTGCCAAAGG + Intronic
1095195455 12:39309919-39309941 GTCTTTGAGCCTGTTGCAGAGGG - Intronic
1096572379 12:52531103-52531125 TTCTTGGAGGGGAGTGGAGAGGG - Intergenic
1096953686 12:55503403-55503425 GTCTGTGAGGGTCTTGCCGAAGG - Intergenic
1096964187 12:55611989-55612011 GTAGTGGAGGGGCTTGCAGATGG - Intergenic
1097346716 12:58501455-58501477 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1098327331 12:69316315-69316337 CTCTGTGAGGGCAGTGCAGAAGG - Intergenic
1098659177 12:73071631-73071653 GTCTGTGAGGGTGTTGCCGAAGG + Intergenic
1099282245 12:80665262-80665284 GTCTGTGAGGGTATTGCCAAAGG - Intronic
1099380108 12:81942388-81942410 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1099598399 12:84699294-84699316 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1104216800 12:126741729-126741751 CTCTTTGAGGGGGTGCCAGATGG + Intergenic
1106531403 13:30595949-30595971 GTCTGGGAGGGGACTGCATAAGG + Intronic
1107308730 13:39052930-39052952 GTCTGTGAGAGGGTTGCCGAAGG + Intergenic
1107324994 13:39232039-39232061 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1107637908 13:42411506-42411528 GTCTATGAGGGTATTTCTGAAGG - Intergenic
1108828746 13:54451429-54451451 GTCTTTGGGTAGACTGCAGAGGG + Intergenic
1111256427 13:85675635-85675657 GTCTTTAAAGGGATTAGAGAGGG - Intergenic
1111536014 13:89604174-89604196 GTCTGTGAGGGTGTTGCAAAAGG - Intergenic
1112619128 13:101036711-101036733 GGGTGTGAGGGAATTGCAGAGGG + Intergenic
1114187597 14:20414566-20414588 GTCTTCCTTGGGATTGCAGATGG - Intergenic
1115014232 14:28590606-28590628 GTCTTTGAGGGTGTTGCCAAAGG + Intergenic
1115277318 14:31622820-31622842 TTCTTTTAGGGCAATGCAGAGGG + Intronic
1115313265 14:32001132-32001154 GTGATTGAGGTGATTGGAGATGG + Intergenic
1116054159 14:39841845-39841867 GCATTTGGGGGGATTGCACATGG - Intergenic
1116068386 14:40011581-40011603 GTCTTTGAGGGTGTTGCCAAAGG + Intergenic
1116216344 14:42022179-42022201 GTCTTTTAGGAGGTAGCAGATGG + Intergenic
1116248683 14:42454467-42454489 GTCTTTGAGGGTGTTGCCAAAGG + Intergenic
1116389603 14:44376918-44376940 CTCTTCTAGGGCATTGCAGAAGG - Intergenic
1116665257 14:47766329-47766351 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1116779782 14:49224271-49224293 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1117462315 14:55957338-55957360 GGCTTTGAGGTTATTGCAAATGG + Intergenic
1120873375 14:89357903-89357925 GTCAATGAGGGTATAGCAGAGGG - Intronic
1120921051 14:89755732-89755754 CTCTGTGAGGGCAGTGCAGAAGG - Intergenic
1121717203 14:96084789-96084811 GTCCTTGAGGGGATGGAATAGGG - Intronic
1122542153 14:102504612-102504634 GTCTGGGAGGGGGTTGCAGGGGG + Exonic
1122883132 14:104699029-104699051 GTCTTTCAGGGGCTTGCACAGGG + Intronic
1125047185 15:35255282-35255304 CTATTTGAGGGGATTTAAGAAGG - Intronic
1126072937 15:44882002-44882024 ATCTCTGAGGGAATTGCTGATGG - Intergenic
1126085315 15:45005646-45005668 ATCTCTGAGGGAATTGCTGATGG + Intergenic
1127065559 15:55234187-55234209 GTGTTGGAGGGGAAGGCAGAAGG - Intronic
1127122028 15:55780100-55780122 GTCCTTGAGGGGTTAGGAGATGG + Intergenic
1127380045 15:58423133-58423155 GTCTGTGAGGGTATTGCCAAAGG + Intronic
1128393646 15:67201212-67201234 TTCTTTGAGGTGATTGCATTAGG - Exonic
1129935881 15:79449936-79449958 GTCTTTGCGGCCACTGCAGATGG + Intronic
1130272072 15:82457013-82457035 GTCTGTGAGGGCATTGTAAAAGG + Intergenic
1130464424 15:84184402-84184424 GTCTGTGAGGGCATTGTAAAAGG + Intergenic
1130488263 15:84410420-84410442 GTCTGTGAGGGCATTGTAAAAGG - Intergenic
1130499843 15:84489135-84489157 GTCTGTGAGGGCATTGTAAAAGG - Intergenic
1130586716 15:85189035-85189057 GTCTGTGAGGGCATTGTAAAAGG + Intergenic
1130772532 15:86939159-86939181 GTCTGTGAGGGTATTGCCAAAGG + Intronic
1130907331 15:88249920-88249942 ATCTTTGAGGGACTTGCAAAGGG - Intronic
1135612119 16:23877462-23877484 GTCTTATATGGGATTGTAGAGGG - Intronic
1135942054 16:26830489-26830511 GTCTGTGAGAGGGCTGCAGAGGG - Intergenic
1137953966 16:52810200-52810222 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1138852489 16:60645600-60645622 CTCCTTGAGTGGACTGCAGAGGG - Intergenic
1138970973 16:62142188-62142210 GTCTGTGAGGGGGTTGCCTAAGG - Intergenic
1140232059 16:73125461-73125483 GTCTGTGAGGGTGTTGCAGAAGG + Intergenic
1141488037 16:84354058-84354080 GTCTTTGTGGGGGTTGGAGAAGG + Intergenic
1142678853 17:1533597-1533619 GTCTTGGCGTGGATCGCAGAAGG - Intronic
1143168128 17:4909279-4909301 GTCTTTGTGTGGAGTGGAGAGGG - Intergenic
1143176844 17:4960317-4960339 GTCTGGGATGGGATGGCAGAGGG + Exonic
1143912245 17:10260787-10260809 GACTTTAAGGTGATTGCAAAGGG + Intergenic
1144476379 17:15592775-15592797 GTGTTTGTGGGAATTGCAGTGGG - Intronic
1144921879 17:18770627-18770649 GTGTTTGTGGGAATTGCAGTGGG + Intronic
1146984791 17:37205250-37205272 TTTTATGAGGGGATTGGAGAGGG + Intronic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1149498934 17:57136627-57136649 GTATTTGAGGTGCTTGGAGATGG + Intergenic
1150956249 17:69863307-69863329 GTCTGTGAGGGCATTGCCAAAGG - Intergenic
1151042622 17:70881242-70881264 TTCTTGGAGAGGATTACAGATGG + Intergenic
1153527938 18:6015340-6015362 GTGTTTGAGAAGATTGCAGAAGG + Intronic
1153952820 18:10071366-10071388 GGCTGTTAGGGGCTTGCAGAGGG + Intergenic
1156014465 18:32532472-32532494 GTGCTTGAGGGGATTGAGGAAGG + Intergenic
1156510062 18:37628764-37628786 GTCTGTGAGGGTGTTGCAAAAGG - Intergenic
1157416890 18:47510857-47510879 GTGTTTTGGGGGATTGGAGAGGG + Intergenic
1157733506 18:50025401-50025423 GTTTTTAAGGGGATCACAGAGGG - Intronic
1157753844 18:50200725-50200747 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1158162176 18:54497337-54497359 GTCTCTGAGGGTATAGCTGATGG + Intergenic
1159438271 18:68445911-68445933 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1159756900 18:72376830-72376852 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1160092753 18:75842448-75842470 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1161122121 19:2534476-2534498 TTCTTTGATGGGATTGGAGCTGG - Intronic
1162286068 19:9739870-9739892 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1163145099 19:15374438-15374460 GTATATGGGGGGACTGCAGAGGG - Intronic
1167589951 19:50399032-50399054 GTCCTGGAGGGGGTTGCAGACGG + Exonic
1167667427 19:50830937-50830959 GTCTTTGAGGGGATTAAATGTGG - Intronic
1167976252 19:53228677-53228699 CTCCTTGAGGAGAATGCAGATGG + Intergenic
925009706 2:473930-473952 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
925733657 2:6942100-6942122 ATCTTGGAGGATATTGCAGATGG + Intronic
925798740 2:7575115-7575137 CTTTTTGAGGGGATTGGAGGGGG + Intergenic
926916432 2:17896453-17896475 GACTTTGGGGGCATTGGAGACGG + Intronic
927085696 2:19672406-19672428 GCCTTAGAGAGGTTTGCAGATGG - Intergenic
928536256 2:32244659-32244681 TTTTTTGTGGGGTTTGCAGAAGG - Intronic
931145482 2:59512361-59512383 GTCTTTGAGGGTATTTCTGAAGG - Intergenic
931999737 2:67873674-67873696 GTTTTTGAGAAGCTTGCAGAGGG - Intergenic
932975456 2:76594860-76594882 GTCTGTGAGGGTGTTGCCGAAGG + Intergenic
933266173 2:80182436-80182458 GTCTGTGAGGGTATTGCCAAAGG - Intronic
934566401 2:95344003-95344025 GTCCTTGGGGTGATTGGAGAAGG - Intronic
937866089 2:126752865-126752887 GTGTTTGAGGGGATGGCCCACGG - Intergenic
938391572 2:130911029-130911051 GTTATTGAGGAGTTTGCAGAGGG + Intronic
939410323 2:141816242-141816264 GTCTGTGAGGGGGTTGCCAAAGG + Intronic
940372157 2:152915664-152915686 GCCTTTGAGGGGCTTTCAGTAGG - Intergenic
941715644 2:168760469-168760491 GTCTGTGAGGGTATTGCCAAAGG - Intronic
941852157 2:170195104-170195126 GTCTGTGAGGGTGTTGCAAAAGG - Intronic
943922663 2:193729431-193729453 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
944628944 2:201602630-201602652 GTGATTGAGGTGATTACAGATGG + Intronic
945120780 2:206455069-206455091 CTCTATGAGGGCAGTGCAGAGGG - Intronic
945333065 2:208561610-208561632 GTCTGTGAGGGTATTGCCAAAGG - Intronic
945726243 2:213474877-213474899 GTCTGTGAGGGTATTGCCAAAGG - Intronic
946914198 2:224499714-224499736 GTCTGTGAGCTGATTGCACAAGG - Intronic
947234303 2:227923608-227923630 ATGTTTGAGGGGACGGCAGAGGG + Intronic
948285327 2:236779931-236779953 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
948664511 2:239526684-239526706 GTCTGTGGGAGGATTGCACAGGG + Intergenic
1169312236 20:4553820-4553842 GTTATTCAGGGGATTCCAGATGG + Intergenic
1169404419 20:5311618-5311640 GTCTGTGAGGGCATTGCCAAAGG + Intronic
1169725597 20:8726035-8726057 GCCTTAGAGTGGATTGGAGAAGG + Intronic
1169800960 20:9511068-9511090 GTCTGTGTGTGGGTTGCAGAGGG + Intergenic
1170586399 20:17737673-17737695 GTCTATGAGGGCATTGCCAAAGG + Intergenic
1171242799 20:23585594-23585616 GCCTTAGTGGGGAGTGCAGAGGG + Intergenic
1173709594 20:45142887-45142909 GTCTTTGAGGGTGTTGCCAAAGG - Intergenic
1175313992 20:58033163-58033185 GTCTGTGAGGGGGAAGCAGAGGG + Intergenic
1175497631 20:59425750-59425772 CTCCTGGAGGGGATTGCTGATGG + Intergenic
1176895832 21:14377591-14377613 GTCTGTGAGGGTATTGCCAAAGG + Intronic
1176967246 21:15224985-15225007 GTCTTTGAGGGTGTTGCCAAAGG - Intergenic
1178011511 21:28291558-28291580 GTCTGTGAGGGGGTTGCCAAAGG - Intergenic
1179442116 21:41402449-41402471 GTCTTTGGGGGGCAGGCAGAGGG + Intronic
1181141846 22:20811383-20811405 GTCTGGGAGGGGATTGCAAGAGG - Intronic
1181689226 22:24549128-24549150 GGATTTGAGGGGATTCCTGAAGG - Intronic
1182364607 22:29770020-29770042 GCCTTTGGGGTGTTTGCAGAGGG - Exonic
1182907623 22:33951613-33951635 GTCTGTGAGGGGGTTGCCAAAGG - Intergenic
1183279440 22:36924158-36924180 GTCTTTGAGGAGAATGGAGAAGG - Intronic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1183284170 22:36952159-36952181 GTATTTGAGGAGAATGGAGAAGG + Intergenic
1183319504 22:37156510-37156532 GTCTATGAGGAGATGGGAGAAGG - Intronic
1183351374 22:37336609-37336631 GTCTTGGAGGGGCATGTAGAAGG - Intergenic
1183361983 22:37387604-37387626 GTCTGTGGGGAGATTTCAGAAGG - Intronic
1183774119 22:39951759-39951781 GTATTTGAGGGGAGGGGAGATGG - Intronic
949445921 3:4133481-4133503 GTCTGTGAGGGTGTTGCTGAAGG + Intronic
949633592 3:5957279-5957301 GTCTTTGAGGGTGTTGCCAAAGG + Intergenic
951384827 3:22029939-22029961 GTCTGTGAGGGTGTTGCTGAAGG + Intronic
952559706 3:34577076-34577098 GATTTTGAAGGGATTGGAGATGG + Intergenic
954582818 3:51712201-51712223 GTCTAAAAGGGGATGGCAGAGGG + Intronic
954698361 3:52439373-52439395 GTCCTACAGGGGTTTGCAGAAGG + Intronic
954810662 3:53245328-53245350 GTCCTGGAGGGGAGTGGAGAGGG - Intronic
955333346 3:58065549-58065571 GTCATTGTGAGGATTGCACAAGG + Intronic
957029291 3:75221483-75221505 ATCGTTGAGGGGAATTCAGATGG - Intergenic
957117892 3:76050083-76050105 GTCTTTGAGGGTATTGCCAAAGG + Intronic
957452160 3:80393095-80393117 GTCTGTGAGGGGGTTGCCAAAGG - Intergenic
957633970 3:82758390-82758412 GTCTTTGAGGGTATTGCCAAAGG + Intergenic
957634510 3:82762851-82762873 GTCTTTGAGGGTGTTGCCAAAGG + Intergenic
957742490 3:84289676-84289698 GTCTTTGAGTTGATTTCTGAAGG + Intergenic
958778150 3:98510040-98510062 GTCTTTGAGGGTATTGCCAAAGG - Intronic
958845935 3:99263979-99264001 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
959339655 3:105112880-105112902 GTCTGTGAGGGTGTTGCTGAAGG - Intergenic
959650006 3:108742321-108742343 GTCTGTGAGGGTGTTGCCGAAGG - Intergenic
960526336 3:118715203-118715225 GTCTGTGAGGGTATTTCTGAAGG - Intergenic
960909704 3:122637074-122637096 GTCTGGGAGGGAATTGCACAAGG + Intronic
961961324 3:130858211-130858233 GTCTATGAGGGTATTGCCAAAGG - Intronic
963500691 3:146121689-146121711 GTTTTTCAGGGAATTGCAGAGGG + Intronic
965071297 3:163918096-163918118 GTCTTTGAGGGTGTTGCCAAAGG + Intergenic
965094596 3:164208928-164208950 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
967804576 3:193704201-193704223 GGCTTTGAGGGGGCTGAAGAAGG - Intergenic
968771439 4:2510066-2510088 CTCTTAGAGGAGACTGCAGACGG - Intronic
968916235 4:3498131-3498153 GTCTGGGAGGAGAGTGCAGAAGG + Intronic
969957244 4:10903456-10903478 GAATATGAGGGGATGGCAGATGG + Intergenic
970084675 4:12333308-12333330 GTCTGTGAGGGCATTGCCAAAGG - Intergenic
971117852 4:23668661-23668683 GTCTTTGAGGGTGTTGCCAAAGG - Intergenic
971601381 4:28596038-28596060 CTCTTTTAGGGCAGTGCAGAAGG + Intergenic
971824540 4:31604218-31604240 GTCTTCGAGGGCATTGCCAAAGG - Intergenic
972163547 4:36254769-36254791 GTCATTGAGTGGATTTAAGAGGG + Intergenic
972187040 4:36541913-36541935 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
975477691 4:74842348-74842370 GTCTGTGAGGGAATTGCCAAAGG - Intergenic
976504090 4:85826290-85826312 GTGTTTGAGGGGGATGGAGAAGG - Intronic
977351896 4:95898780-95898802 CTCTTTGAGTGCATTACAGAAGG - Intergenic
977627062 4:99199015-99199037 GTCTGTGAGGGTGTTGCAAAAGG - Intergenic
977768882 4:100833110-100833132 GTCTTTCAGGGAAATGCATATGG + Intronic
977988136 4:103409664-103409686 GTCTTGGATGGGCTTGCAGGTGG - Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
979556364 4:122051918-122051940 GTTTTTCAGGGGATGACAGACGG + Intergenic
979832906 4:125322532-125322554 GTCTTTGAGGGGCCTGGGGAGGG - Intronic
979887055 4:126041050-126041072 GTCTTTGAGGGTGTTGCCAAAGG + Intergenic
980602200 4:135039950-135039972 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
980602516 4:135042436-135042458 GTCTGTGAGGGCATTGCCAAAGG + Intergenic
980702872 4:136455324-136455346 GTCTGTGAGGGTATTGCCAAGGG + Intergenic
980867689 4:138572673-138572695 GTTGTTGAGGGGATTGAATAAGG + Intergenic
981391557 4:144197023-144197045 CTCTTTTAGGGCAGTGCAGAGGG + Intergenic
983049106 4:163023340-163023362 GTCTGTGAGGGTATTGCCGAAGG + Intergenic
985620315 5:951584-951606 GGCTTTGAGGAGATGGCAGAGGG - Intergenic
986100472 5:4604916-4604938 GTCTTTAAAGCTATTGCAGAGGG + Intergenic
986837936 5:11662611-11662633 GTCTGTGAGGGTGTTGCCGAAGG - Intronic
986987655 5:13517161-13517183 GTCTGTGAGGGCATTGCCAAAGG + Intergenic
988092733 5:26563711-26563733 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
988204999 5:28122895-28122917 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
988396331 5:30701211-30701233 CTTTTTTAGGGCATTGCAGAAGG + Intergenic
989458099 5:41665425-41665447 GTCTGTGAGGGTGTTGCTGAAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989985717 5:50695092-50695114 GTCTGTGAGGGGGTTGCCAAAGG - Intronic
990003531 5:50921773-50921795 GTCTTAGAGGGTAATGCAGCCGG + Intergenic
990078822 5:51886464-51886486 GTCTATGAGGGGGTTGCTAAAGG - Intergenic
991089475 5:62680059-62680081 ATCTTTCAGGGGATTGGAGAGGG + Intergenic
991259394 5:64650620-64650642 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
991310476 5:65235458-65235480 GTCTGTGAGGGTATTGCTAAAGG + Intronic
993036393 5:82762250-82762272 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
994527401 5:100924174-100924196 TTGTTTGAGGAGACTGCAGATGG + Intergenic
995227423 5:109717069-109717091 TTTTTTGTGGGGATTGGAGAGGG + Intronic
995994121 5:118279037-118279059 ATCTTTGAGGAGATGGGAGAGGG - Intergenic
996164635 5:120209983-120210005 GTCTGTGAGGGTGTTGCAAAAGG - Intergenic
996250458 5:121323085-121323107 GTCTTTCAGGGGATAGTAAAAGG - Intergenic
997179558 5:131814153-131814175 GTCTGTGAGGGTATTGCCAAAGG - Intronic
997259405 5:132454487-132454509 GGCTCTGAAGGGCTTGCAGAGGG - Intronic
997408997 5:133675818-133675840 ACCTCTCAGGGGATTGCAGAAGG + Intergenic
998486113 5:142504033-142504055 GTCTATGAGGGTATTGCCAAAGG + Intergenic
999195375 5:149778223-149778245 GTCTTGGAGGGGATGACAGAAGG + Intronic
999305347 5:150515868-150515890 GCCTCTGAGTGGGTTGCAGAGGG + Intronic
999660002 5:153851114-153851136 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1000419233 5:161019282-161019304 GTCTTTGAGGGTGTTGCCAAAGG + Intergenic
1001397478 5:171427709-171427731 GGTTTTGAGGGGAATGAAGAAGG + Intronic
1001698462 5:173689949-173689971 TTCTTTCAGGGCATGGCAGAAGG + Intergenic
1001740134 5:174046272-174046294 GTGTTTTAGGGTATTGCTGATGG + Intronic
1003782042 6:9440109-9440131 GTCTTTGTGATGATTGCACAAGG + Intergenic
1004107949 6:12683895-12683917 GTCTGTGAGGGGGTTGCCAAAGG + Intergenic
1004127160 6:12885065-12885087 GTCTCTGAGTGGGTTGAAGAGGG - Intronic
1004138551 6:12992141-12992163 GATTTGGAGGGGATTGGAGAAGG - Intronic
1004490249 6:16108341-16108363 GTCTCTGAGGTGGTTGGAGATGG - Intergenic
1005339686 6:24831551-24831573 GTCTCTGAGGGGCATGAAGAGGG - Intronic
1005376479 6:25187610-25187632 GTCTTTGATGGGATTTAAGGGGG - Intergenic
1006030193 6:31172179-31172201 GTCTTTGAGGGGATTGCAGAGGG - Intronic
1006330695 6:33388556-33388578 GTCTTTCAGGGGAGGACAGATGG - Intergenic
1006995500 6:38256115-38256137 GTCTGAGAGAGGATTGCATAAGG + Intronic
1008997146 6:57672485-57672507 GCCTTTGAGCAGAATGCAGAAGG - Intergenic
1009555072 6:65152532-65152554 GTCTCTGCTTGGATTGCAGATGG - Intronic
1009730008 6:67589867-67589889 GTCTTTGAGGGTGTTGCCAAAGG + Intergenic
1009851586 6:69206374-69206396 GTCTGTGAGGGCATTGCCAAAGG - Intronic
1009970151 6:70616810-70616832 GTCTGTGAGGGTGTTGCGGAAGG + Intergenic
1010325775 6:74560475-74560497 GTCTATGAGGGTATTGCCAAAGG - Intergenic
1010462927 6:76133792-76133814 GTCTCTGCAGGGATGGCAGATGG + Intergenic
1010623025 6:78100385-78100407 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1010649390 6:78433761-78433783 GTCTATGAGAAGAGTGCAGATGG - Intergenic
1012344922 6:98173012-98173034 GTCTGTGAGGGTGTTGCTGAAGG + Intergenic
1014160111 6:118157845-118157867 GTCTTTGAGGGTGTTGCCAAAGG - Intronic
1014416556 6:121191750-121191772 GTCTGTGAGGGTGTTGCCGATGG + Intronic
1015205246 6:130630861-130630883 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1015318338 6:131842862-131842884 GTATTTGAGGGAATTGGTGAGGG + Intronic
1015474908 6:133649514-133649536 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1015494625 6:133866865-133866887 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1016266043 6:142233504-142233526 GTCTGTGAGGGCATTGCCAAAGG - Intergenic
1016301376 6:142635603-142635625 GTCTATGAGGGTATTGCCAAAGG + Intergenic
1019494679 7:1332234-1332256 GCCTTTGAGGGGACTGAAGGAGG + Intergenic
1019613091 7:1946791-1946813 GTCTTGGAGGGGTCTGCACAGGG + Intronic
1021942457 7:25691271-25691293 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1022137690 7:27465096-27465118 GTCTTCATGGGGATTACAGATGG - Intergenic
1022201807 7:28124259-28124281 CTCTTTGTGTGGCTTGCAGATGG - Intronic
1022726537 7:32986696-32986718 GTCTTTGAGGGGTATTGAGAAGG + Intronic
1023287432 7:38633453-38633475 GTCTATGAGGGTGTTGCCGAAGG + Intergenic
1024431400 7:49292139-49292161 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1024993395 7:55253721-55253743 GTCTGTGAGGGTATTGCCAAAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026823078 7:73562744-73562766 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1028541826 7:91950660-91950682 GACCTTGTGGGGATTGCAGTGGG + Intronic
1029006743 7:97218803-97218825 TTCTTTAAGGGTATTGCATAAGG - Intergenic
1029334159 7:99886553-99886575 GTCTGTGAGGGTGTTGCCGAAGG + Intronic
1029975981 7:104834191-104834213 GTCTGTGAGGGTATTGCCAAAGG - Intronic
1030090568 7:105854220-105854242 GCCTTTGAATGGATTACAGATGG - Intronic
1030299300 7:107959425-107959447 GCCAGTGACGGGATTGCAGAAGG + Exonic
1030547810 7:110919812-110919834 GTCTGTGAGGGTGTTGCCGAAGG + Intronic
1033627155 7:143121803-143121825 GTCTTTGAGGGTGTTGCCAAAGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034152460 7:148927776-148927798 TGCTTTGAAGGGATTACAGATGG - Intergenic
1035369318 7:158368937-158368959 GTCTGTGAGGGCGTTGCCGAAGG + Intronic
1035392961 7:158517545-158517567 CTGTTGGAGGAGATTGCAGAGGG - Intronic
1037144156 8:15553314-15553336 ATCTTTGAGGGGTTTGCAACAGG - Intronic
1038350373 8:26770831-26770853 GTCTTTGAAGATATTGCAAAAGG - Intronic
1038891834 8:31734092-31734114 GGCTTTGAGAGGATTGCATGAGG + Intronic
1039280041 8:35974574-35974596 GTCTGTGAGGGTGTTGCAAAAGG - Intergenic
1040818323 8:51531758-51531780 GTCTTGGAGGTGATAGAAGAGGG + Intronic
1042989234 8:74620401-74620423 CTCTGTGAGGGCAGTGCAGAAGG - Intronic
1043566481 8:81554336-81554358 GTTTTTGAGGGGATTGAAATAGG - Intergenic
1044028276 8:87201612-87201634 GTCTTTGAGGGTATTCTAAATGG - Intronic
1044147865 8:88740231-88740253 GTCTGTGAGGGTGTTGCTGAAGG + Intergenic
1044202689 8:89454886-89454908 GTCTGTGAGGGCATTGCCAAAGG + Intergenic
1044633896 8:94303462-94303484 GTCTGTGAGGGTGTTGCCGAAGG - Intergenic
1044895773 8:96889916-96889938 GTCTTTGAGGGTGTTGCCAAAGG - Intronic
1046044191 8:108944418-108944440 GTCTTTGGAGGGCTTGGAGAAGG - Intergenic
1046418102 8:113941461-113941483 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1046927563 8:119808421-119808443 GACTTTGAGGGGTTTAGAGAAGG - Intronic
1047159896 8:122366422-122366444 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1047545497 8:125812615-125812637 GTCTGTGAGGGTGTTTCAGAAGG + Intergenic
1049330145 8:142046103-142046125 ATCTTTCAGGGGACTGCAGCAGG - Intergenic
1049618718 8:143588317-143588339 GACTTGGAGGGGAATACAGAGGG - Intronic
1050612153 9:7364174-7364196 GTGTTGGAGGGGAAGGCAGAGGG - Intergenic
1051475048 9:17496978-17497000 GTCTTGCAGGGGGTTGGAGAAGG + Intronic
1051841891 9:21407152-21407174 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1051965978 9:22830584-22830606 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1052556680 9:30027428-30027450 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1052709057 9:32030382-32030404 GTCTGTGAGGGCATTGCCAAAGG - Intergenic
1055255964 9:74371508-74371530 GGCTTTCATGGGATTGCGGAAGG - Intergenic
1056087071 9:83161060-83161082 CTCTGTCAGGGGAGTGCAGAAGG + Intergenic
1056579152 9:87877644-87877666 GTCTTTGGAGGGATTGCTGTGGG + Intergenic
1056956529 9:91086210-91086232 GTCTGTGAGGGCATTGCCAAAGG + Intergenic
1057100291 9:92352840-92352862 GTCTGTGAGGGTATTGCCAAAGG - Intronic
1057545886 9:96020513-96020535 GTCTTTGAGGGCATTTTAGGAGG - Intergenic
1058391875 9:104504636-104504658 GTATCTCAGGGGGTTGCAGATGG - Exonic
1058776450 9:108288890-108288912 GTGTTCGAGGGGCTTGCATAAGG + Intergenic
1059440331 9:114303011-114303033 GTCTTTGAGGATGGTGCAGAGGG - Intronic
1059833589 9:118126116-118126138 GTCTGTGAGGGTGTTGCCGAAGG + Intergenic
1060666129 9:125433215-125433237 GCATTTGAGGGCTTTGCAGATGG - Intergenic
1061187112 9:129061088-129061110 GTCTCTGAGGGGATGTCAGAGGG - Intronic
1061262499 9:129487990-129488012 GTCTCTGTGGGGCTTGGAGAAGG - Intergenic
1062442685 9:136578236-136578258 GTGTTTGTGGGGATTTCAGCAGG - Intergenic
1062562174 9:137146491-137146513 GTCTTGGTGAGGAGTGCAGAGGG - Intronic
1185768531 X:2746793-2746815 GTCTGTGAGGGTGTTGCCGAAGG - Intergenic
1188194592 X:27217261-27217283 GCCATTGAGGGCCTTGCAGAGGG + Intergenic
1188852471 X:35149463-35149485 GTCATTAAAGGGATTGCTGAAGG - Intergenic
1189424310 X:40884199-40884221 GTCTGTGAGGGCATTGCCAAAGG - Intergenic
1190740063 X:53282720-53282742 GGCTTTGAGGGGTGGGCAGAGGG - Intronic
1190959420 X:55230676-55230698 GTCTGTGAGGGTATTGCCAAAGG - Intronic
1192216297 X:69161680-69161702 CTCTTTGATGGATTTGCAGATGG - Exonic
1193239213 X:79146844-79146866 ATCTATGAGCGGAATGCAGAAGG - Intergenic
1193446788 X:81615580-81615602 GTCTTTGAGGGCACTGCCAAAGG + Intergenic
1194174637 X:90630656-90630678 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1194177649 X:90670914-90670936 GTCTTTGAGGGTGTTTCAGGAGG - Intergenic
1194410121 X:93546947-93546969 GTCTTTGAGGGCATTCCAAGAGG - Intergenic
1195270866 X:103229324-103229346 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1195870843 X:109483826-109483848 GTCTTTGGAGGGATAGCACAAGG - Intergenic
1196371027 X:114980089-114980111 GGCTTGGCAGGGATTGCAGAAGG + Intergenic
1197075870 X:122351521-122351543 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1197426944 X:126308299-126308321 GTCTGTGAGGGTATTGCCAAAGG - Intergenic
1197529414 X:127604859-127604881 GTCTGTGAGGGTATTGCCAAGGG + Intergenic
1198651667 X:138869875-138869897 GTCCTTGCAGGGATTACAGATGG + Intronic
1200520850 Y:4208356-4208378 GTCTGTGAGGGTATTGCCAAAGG + Intergenic
1200524320 Y:4253063-4253085 GTCTTTGAGGGTGTTTCAGGAGG - Intergenic