ID: 1006033527

View in Genome Browser
Species Human (GRCh38)
Location 6:31194976-31194998
Sequence CTCCTTACTCTCACTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006033527_1006033532 17 Left 1006033527 6:31194976-31194998 CCAATTTCAGTGAGAGTAAGGAG No data
Right 1006033532 6:31195016-31195038 TCACTAGGAGTGACAATGGCTGG No data
1006033527_1006033533 30 Left 1006033527 6:31194976-31194998 CCAATTTCAGTGAGAGTAAGGAG No data
Right 1006033533 6:31195029-31195051 CAATGGCTGGCTTGAAGATTAGG No data
1006033527_1006033529 2 Left 1006033527 6:31194976-31194998 CCAATTTCAGTGAGAGTAAGGAG No data
Right 1006033529 6:31195001-31195023 TATCCAATGGAAGTGTCACTAGG No data
1006033527_1006033531 13 Left 1006033527 6:31194976-31194998 CCAATTTCAGTGAGAGTAAGGAG No data
Right 1006033531 6:31195012-31195034 AGTGTCACTAGGAGTGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006033527 Original CRISPR CTCCTTACTCTCACTGAAAT TGG (reversed) Intergenic
No off target data available for this crispr