ID: 1006034290

View in Genome Browser
Species Human (GRCh38)
Location 6:31199486-31199508
Sequence ACCTTGGATTGCTGGGTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006034280_1006034290 28 Left 1006034280 6:31199435-31199457 CCTGGGGGACAAGAGCAAAACTC 0: 88
1: 2594
2: 15819
3: 27637
4: 33344
Right 1006034290 6:31199486-31199508 ACCTTGGATTGCTGGGTCGGGGG No data
1006034281_1006034290 6 Left 1006034281 6:31199457-31199479 CCGTCTCAAAAAAAAAAAAGATA 0: 89
1: 3505
2: 101204
3: 84336
4: 94738
Right 1006034290 6:31199486-31199508 ACCTTGGATTGCTGGGTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006034290 Original CRISPR ACCTTGGATTGCTGGGTCGG GGG Intronic
No off target data available for this crispr