ID: 1006035888

View in Genome Browser
Species Human (GRCh38)
Location 6:31211822-31211844
Sequence GATGTATTATAACCAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006035888_1006035896 29 Left 1006035888 6:31211822-31211844 CCAGATTTTGGTTATAATACATC No data
Right 1006035896 6:31211874-31211896 TAGAAAAATAGCTGATTCTAGGG No data
1006035888_1006035897 30 Left 1006035888 6:31211822-31211844 CCAGATTTTGGTTATAATACATC No data
Right 1006035897 6:31211875-31211897 AGAAAAATAGCTGATTCTAGGGG No data
1006035888_1006035895 28 Left 1006035888 6:31211822-31211844 CCAGATTTTGGTTATAATACATC No data
Right 1006035895 6:31211873-31211895 TTAGAAAAATAGCTGATTCTAGG No data
1006035888_1006035889 -7 Left 1006035888 6:31211822-31211844 CCAGATTTTGGTTATAATACATC No data
Right 1006035889 6:31211838-31211860 ATACATCAATCTCCAATAGAAGG No data
1006035888_1006035891 1 Left 1006035888 6:31211822-31211844 CCAGATTTTGGTTATAATACATC No data
Right 1006035891 6:31211846-31211868 ATCTCCAATAGAAGGAACCAGGG No data
1006035888_1006035890 0 Left 1006035888 6:31211822-31211844 CCAGATTTTGGTTATAATACATC No data
Right 1006035890 6:31211845-31211867 AATCTCCAATAGAAGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006035888 Original CRISPR GATGTATTATAACCAAAATC TGG (reversed) Intergenic
No off target data available for this crispr