ID: 1006042427

View in Genome Browser
Species Human (GRCh38)
Location 6:31267473-31267495
Sequence GAATTGAGAGGCGAGGGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006042427_1006042434 29 Left 1006042427 6:31267473-31267495 CCTCGTCCCTCGCCTCTCAATTC 0: 2
1: 0
2: 0
3: 6
4: 186
Right 1006042434 6:31267525-31267547 TTAAGAAAGAAGTCATATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006042427 Original CRISPR GAATTGAGAGGCGAGGGACG AGG (reversed) Intergenic
900607775 1:3531424-3531446 GAACTTAAAGGCGAGGGGCGGGG - Intronic
902044355 1:13513787-13513809 GGATGGAGAGGGGAGGGGCGGGG + Exonic
902686275 1:18079742-18079764 GAAGTGAGAGGTGAGGGCTGAGG + Intergenic
902726228 1:18337965-18337987 GAATGGTGAGGGGAGGGCCGGGG + Intronic
905594026 1:39190305-39190327 GAAGAGAGAGGAGAGGGGCGGGG - Intronic
907390130 1:54152798-54152820 GAACTGAGAGGGGAAGGAGGTGG - Intronic
908109724 1:60884514-60884536 TCATTCAGAGGCCAGGGACGGGG + Intronic
908154351 1:61337162-61337184 AAATTCAGAGGTGAGGGATGAGG + Intronic
909657123 1:78044657-78044679 GATGTGAGAGGTGAGGGAAGAGG + Intronic
913476806 1:119245720-119245742 GAATTGAGAAGAGAGGGAGAGGG - Intergenic
916262769 1:162859290-162859312 TAATTGACAGGGGAGGGACAAGG + Intronic
917127479 1:171700276-171700298 GAATTGAGAAGCTAGGGAACAGG + Exonic
921118533 1:212116997-212117019 GAATTGACAGGAGAGGGGTGTGG + Intergenic
921383431 1:214547824-214547846 AAATTGAGAGGTGGGGGACCAGG - Intronic
923508435 1:234627311-234627333 GAATAGAGAAGAGAGGGACTTGG - Intergenic
923673898 1:236064519-236064541 GACTGGACAGCCGAGGGACGCGG + Intronic
1062922929 10:1293302-1293324 GAAGAGAGAGGGGAGGGAGGTGG + Intronic
1063396031 10:5688479-5688501 GCTTTGAGAGGCGAGGCAGGGGG - Intronic
1067234448 10:44436257-44436279 GACTTGAGAGGCAGGGGACAGGG - Intergenic
1067768512 10:49107581-49107603 GAAATGAGAGGTGAGGGTCTTGG - Exonic
1068767346 10:60778505-60778527 AAATTGAGCGGAGAGCGACGCGG + Exonic
1069449319 10:68502970-68502992 GAGTGGAGAGGAGAGGGAAGAGG + Intronic
1070439896 10:76433004-76433026 GAATTGGGAGGGGAGGGAATGGG + Intronic
1073327955 10:102653299-102653321 GAATAGACAGGGGAGGGAGGAGG + Intronic
1076680218 10:132167880-132167902 GGAGTGAGGGGCGAGGGCCGAGG - Intronic
1080012504 11:27472608-27472630 GCATTGAGAGGCCAGGGACAGGG - Exonic
1081597272 11:44467739-44467761 GAAAGGAGAGGCGAGGGAAGGGG - Intergenic
1081755743 11:45543124-45543146 GTAATGAGGTGCGAGGGACGGGG + Intergenic
1083031953 11:59600779-59600801 GATCTCAGAGGTGAGGGACGTGG - Intronic
1083743616 11:64723472-64723494 GAACTAAGGGGCGAGGGGCGAGG - Intergenic
1084944329 11:72630748-72630770 GAATGGAGAGGAGAGGAACTCGG + Intronic
1086539726 11:87894258-87894280 TAATTGAGAGGCAAGGTATGAGG + Intergenic
1089126065 11:116177509-116177531 GAATTGAGAAGGAAGGGAGGAGG + Intergenic
1091710694 12:2738092-2738114 GGATTGGGAGGGGAGGGAGGTGG - Intergenic
1091713548 12:2760157-2760179 GGATTGGGAGGGGAGGGAGGTGG - Intergenic
1094090728 12:26646344-26646366 AAATTGAGATGAGAGGGGCGGGG - Intronic
1095991393 12:48036990-48037012 GAACTGAGGGGCGTGGGAGGTGG + Intergenic
1096796609 12:54081894-54081916 GAAATGAGAGGAGAGGCAAGTGG + Intergenic
1097153749 12:56997656-56997678 GGATTAAGAGGCAAAGGACGTGG - Intergenic
1097617001 12:61896040-61896062 GAAATGAGAGGGAAGGGAGGAGG + Intronic
1101957096 12:109221580-109221602 GGTTTCAGAGGAGAGGGACGTGG - Intronic
1102792189 12:115656881-115656903 TAATTGAGAGGCCAGAGAAGCGG + Intergenic
1104030005 12:125058142-125058164 GAATTTGGAGGCCAGGGAGGGGG + Intergenic
1114409811 14:22490066-22490088 CAACTGAGAGGAGAGGGACTAGG + Intergenic
1114612391 14:24051621-24051643 GATCTGGGAGGCGAGGGGCGGGG - Intergenic
1114944049 14:27656082-27656104 GAATTTAGAGACCAGGGAAGTGG - Intergenic
1117338972 14:54777689-54777711 GAATTGGGAGGTCAGGGAGGAGG + Intronic
1117484957 14:56186624-56186646 GAATTGAGAGGCAGGGAATGAGG + Intronic
1117998584 14:61501829-61501851 GAATTGAGAGACTGGGGACAAGG - Intronic
1118994294 14:70822551-70822573 GAGGGGAGAGGAGAGGGACGGGG - Intergenic
1124711294 15:32014450-32014472 GAATAGGGAGGAGAGGGACATGG + Intergenic
1125334404 15:38613442-38613464 GTCTTGAGAGGAGAGGGAGGAGG + Intergenic
1126330286 15:47524033-47524055 TCAAGGAGAGGCGAGGGACGTGG + Intronic
1129331464 15:74830052-74830074 GAGTTGAGAGGACAGGGAGGAGG - Intronic
1129792194 15:78348807-78348829 GAATGGAGAGGGCAGGGAAGAGG + Intergenic
1130225968 15:82058731-82058753 GAAGGGAGAGGAGAGGGAGGAGG - Intergenic
1132946201 16:2532561-2532583 GAAGGGAGAGGCGAGGCGCGGGG - Intergenic
1135499113 16:22978359-22978381 GAAGTGGGAGGGGAGGGAGGGGG + Intergenic
1135509539 16:23070282-23070304 GAATTGAGTGGTGCGGGAAGGGG - Intronic
1135536961 16:23302176-23302198 TTATTGGGAGGCGAGGGAGGTGG + Intronic
1135552457 16:23408434-23408456 GAAGGGAGAGGCGAGTGGCGGGG + Intronic
1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG + Intergenic
1137405553 16:48186290-48186312 GAATTCAGAGGGGAAGGAGGTGG - Intronic
1139754571 16:69132333-69132355 GAATGGCGAGCCGAGGGGCGGGG - Intronic
1139777015 16:69322707-69322729 GACTTGACAGGGGAGGGAAGAGG + Intronic
1145819541 17:27821452-27821474 GAATTGGGAGAAGAGGGACCTGG - Intronic
1148261644 17:46189314-46189336 GAGTTTAGAGGGGAGGGACTAGG - Intronic
1148458198 17:47822100-47822122 AAAATGAGAGGCGGGGGGCGGGG - Intergenic
1151157001 17:72132049-72132071 GAATGCAGAGGAGAGGGAGGAGG + Intergenic
1151380012 17:73719416-73719438 GAACTGTGAGGCGGGGGAGGCGG - Intergenic
1154393663 18:13967265-13967287 AAATTAAGAGGCCAGGCACGTGG + Intergenic
1157748873 18:50160806-50160828 GAATCGAGAGTGGAGGGACTAGG - Intronic
1159618432 18:70609171-70609193 GAATTTGGAGGCAAGGAACGTGG + Intergenic
1160128088 18:76197753-76197775 GATTTGAGAGGCAAGGAAAGAGG - Intergenic
1160310673 18:77787067-77787089 GAGTTGTGAGGCAAGGGAGGAGG - Intergenic
1161468864 19:4446562-4446584 GAACTGCGAGGCCAGGGGCGAGG + Exonic
1161595919 19:5150971-5150993 TAATCGAGAGGCGAGAGGCGAGG + Intronic
1162015782 19:7845893-7845915 GGGTTGAGAAGCCAGGGACGTGG - Intronic
1162338703 19:10078282-10078304 GAAATGAGAGGAGAGGGGAGGGG + Intergenic
1162548375 19:11344813-11344835 GAAAGGAGAGGGGAGGGAAGAGG - Intronic
1162881995 19:13666633-13666655 GAAGTGTGAGGCGGGGGACCTGG - Intergenic
1166949402 19:46416550-46416572 GAAGGGGGAGGCGAGGGGCGGGG - Intergenic
1167639781 19:50674478-50674500 GAAGTGAGAAGCGAGGGAACTGG - Intronic
1167644228 19:50697076-50697098 GAGGTGAGAGGCGAGGGGCAGGG - Exonic
925012762 2:497953-497975 GATTTGAGAGGAGAGGGATCAGG + Intergenic
926141991 2:10373240-10373262 GGACTCAGAGGCGAGGGAGGTGG + Intronic
930096347 2:47569840-47569862 GAAGGCAGAGCCGAGGGACGCGG + Intronic
934516483 2:94991209-94991231 GAGTTGAGAGGTGATGGACCTGG + Intergenic
934696963 2:96406939-96406961 TACTTGAGAGGCGAGGCAAGAGG - Intergenic
935308390 2:101759626-101759648 GAATGGGGAGGGGAGGGAAGGGG - Intronic
935784596 2:106537206-106537228 GAAGTGAGGGGTGAGAGACGGGG - Intergenic
935918797 2:107986837-107986859 GGTTTTAGAGGGGAGGGACGCGG + Intronic
940805550 2:158182562-158182584 AAATGGAGAGGCGAGAGACAAGG + Intronic
942058369 2:172205961-172205983 GAATTAAGAGGAGAAGGAAGGGG + Intergenic
942071849 2:172323471-172323493 GAAGGGAGAGGCGAGAGACAGGG - Intergenic
942427802 2:175877650-175877672 GATTGGAGAAGCCAGGGACGAGG + Intergenic
948499292 2:238380151-238380173 TAATTGAGAGGGGAGGGGCCTGG - Intronic
1169118493 20:3082338-3082360 GAATTGGGAGGCAGGGGAGGGGG - Intergenic
1170562461 20:17569559-17569581 GGATGGAGAGGGGAGGGAAGAGG - Intergenic
1171072732 20:22091081-22091103 AAATTGAGAGGGGAGGAAAGAGG + Intergenic
1171848070 20:30289909-30289931 GAAATGAGAGGAGAGGCAAGTGG + Intergenic
1173880816 20:46411006-46411028 GAACTGGGGGGTGAGGGACGTGG + Intronic
1174038146 20:47680704-47680726 GAATCCAGAGGCGAGGGAGCTGG + Intronic
1174047669 20:47745043-47745065 GAATTGAGAGGCCAAGAATGAGG + Intronic
1174520953 20:51130310-51130332 GTCTTTAGAGGCGAGGGACCAGG + Intergenic
1177274533 21:18891667-18891689 GAATTGATAGGCGATTGACAGGG + Intergenic
1179150623 21:38805798-38805820 GAAGAGAGAGGGGAGGGAAGGGG - Intronic
1180159359 21:45992196-45992218 GAAAGGAGAGGCGGGCGACGAGG + Exonic
1181646271 22:24233141-24233163 GATTTGAGCAGGGAGGGACGTGG - Intronic
1183363296 22:37394175-37394197 GAAATGAGAGACGAGGGAGAGGG - Intronic
1184258736 22:43302363-43302385 GAAGTGAGTGGAGAGGGAAGCGG + Intronic
950634560 3:14305765-14305787 GAATTGAGGGCCGAGGTTCGCGG + Intergenic
951843612 3:27061809-27061831 CAATAGAGAGCCGAGGGACAGGG - Intergenic
953641356 3:44711137-44711159 GGGTTGAGAGGAGAGGGAAGGGG - Intergenic
955049518 3:55396194-55396216 GAAATGAGAGGCAAGGGATCAGG + Intergenic
955674276 3:61434238-61434260 GAATGGAGAGGCGAGAGGGGTGG - Intergenic
957588339 3:82161536-82161558 GAACTGAGAGGAGAGGGTTGAGG + Intergenic
961439712 3:126945531-126945553 GAATAGAGAGACTCGGGACGGGG + Intronic
962796659 3:138855505-138855527 GATTTGAGAGGTGAGGGAGTAGG + Intergenic
962975107 3:140439284-140439306 GCAGTGAGAGGCCAGGGAGGAGG + Intronic
963173585 3:142275944-142275966 GATTTGGGAGGCGAGGAAGGGGG + Intergenic
963442111 3:145354230-145354252 GAAGTGAGAAGAGAGGGAAGAGG + Intergenic
965816467 3:172641751-172641773 GGCTTGGGAGGGGAGGGACGAGG - Intronic
967813841 3:193782606-193782628 GAATGGAGAGGCGAGTGAGGTGG + Intergenic
975385265 4:73750793-73750815 GAGTTGGGAGGCCAGGGAGGGGG + Intergenic
976832586 4:89331853-89331875 GAATGGAGAGGCGAGGGGGAAGG + Intergenic
977694528 4:99950777-99950799 GGATTGAGAGGGTAGGGAAGGGG - Intergenic
981395345 4:144240785-144240807 GAAAGGAGTGGGGAGGGACGGGG + Intergenic
981910000 4:149967998-149968020 GAATTGAGAGGAGAAGGAAAGGG - Intergenic
984070331 4:175103376-175103398 GAAGGGAGAGGGGAGGGAGGAGG + Intergenic
984070342 4:175103404-175103426 GAAGGGAGAGGGGAGGGAGGAGG + Intergenic
984070352 4:175103429-175103451 GAAGGGAGAGGGGAGGGAGGAGG + Intergenic
984070363 4:175103457-175103479 GAAGGGAGAGGGGAGGGAGGAGG + Intergenic
984070372 4:175103482-175103504 GAAGGGAGAGGGGAGGGAAGAGG + Intergenic
986400682 5:7376533-7376555 GAATTAACAGGCAAGGGAGGAGG - Intergenic
986772584 5:10987642-10987664 GAGTGGGGAGGGGAGGGACGGGG - Intronic
993020960 5:82590231-82590253 GAAAGGAGAGGCCAGGGTCGGGG - Intergenic
997063501 5:130535349-130535371 GAACTGAGAGACTAGGGAAGAGG + Intergenic
998383537 5:141742711-141742733 GAAGTGGGAGGGGAGGGGCGAGG + Intergenic
998805005 5:145909886-145909908 GAATTGGGAAGCGAGGGGTGAGG - Intergenic
998809779 5:145954891-145954913 GAGTGGAGAGGAGAGGGTCGGGG + Intronic
1001020173 5:168176036-168176058 GAATGGAGAGGCCAGGTAAGGGG - Intronic
1002303806 5:178272107-178272129 GAACAGAGAGCCGAGGGATGAGG - Intronic
1005713745 6:28526945-28526967 AATTTTAGAGGCGAGGGATGGGG - Intronic
1005866533 6:29942149-29942171 AAAGTGAAAGGAGAGGGACGGGG + Intronic
1005875199 6:30006193-30006215 AAAGTGAAAGGAGAGGGACGGGG + Intergenic
1006042427 6:31267473-31267495 GAATTGAGAGGCGAGGGACGAGG - Intergenic
1006052016 6:31352560-31352582 GAATTGAGAGGCGAGGGACGAGG - Intronic
1006234020 6:32611734-32611756 GAATTGGGAGGCCAGGGCTGTGG - Intergenic
1007554615 6:42755525-42755547 GAAGTGAGAGGGGAGGCATGTGG - Intronic
1008128060 6:47690800-47690822 GAATTTAGAGGAGAGTGACAAGG + Intronic
1012030387 6:94052729-94052751 GAAGTGAGAGGTGAGGGATGGGG + Intergenic
1014238691 6:118990810-118990832 GAACCGAGAGGCGAGGGTTGTGG + Intronic
1015519677 6:134117779-134117801 GCATTGAGAAGCGAGGGAGATGG - Intergenic
1015857459 6:137640581-137640603 GAATAGAGAGAAGAGGGATGTGG - Intergenic
1016404218 6:143713553-143713575 GCAGTGAGAGGTGAGGGACAGGG + Intronic
1019488111 7:1298781-1298803 GAAATGACAGGCGACGGGCGTGG + Intergenic
1026736668 7:72953476-72953498 GAGTTGAGGGGCGGGGGAGGTGG - Intergenic
1026903268 7:74048590-74048612 GAATGGAGAGGCTAGGGGCCTGG - Intronic
1027107066 7:75411587-75411609 GAGTTGAGGGGCGGGGGAGGTGG + Intergenic
1029193034 7:98785298-98785320 GAAATGAGATGGGAGGGAAGGGG + Intergenic
1029238595 7:99143384-99143406 GAAAAGAGAAGCGAGGGGCGGGG + Intronic
1029971624 7:104795390-104795412 AAAGAAAGAGGCGAGGGACGGGG - Intronic
1030499799 7:110345170-110345192 GAATTCAGAGGAGAGGGAGAGGG + Intergenic
1032348556 7:131139339-131139361 TGAATGAGAGGGGAGGGACGGGG - Intronic
1034485856 7:151361751-151361773 GAATTGGGAGGGGAGGGGCCGGG + Intronic
1035264865 7:157685078-157685100 GAGGCGAGAGGCGAGGGGCGAGG - Intronic
1035638101 8:1162179-1162201 GAACTCGGAGGCGAGGGAGGCGG + Intergenic
1036430480 8:8685271-8685293 GAATGGCGAGGCCAGGGACAGGG - Intergenic
1036822707 8:11953130-11953152 GAAATGAGAGGGGAGGGTCAAGG + Intergenic
1037051093 8:14375070-14375092 GAATTGAGAGGCCAGAAAAGGGG + Intronic
1037862766 8:22417616-22417638 GAATGAAAAGGGGAGGGACGAGG - Intronic
1039200993 8:35094131-35094153 GATTTGAGAGGCAATGGATGAGG + Intergenic
1042541973 8:69916527-69916549 GATTTGAGAGGCCATGGAAGGGG - Intergenic
1044662045 8:94600945-94600967 GAAAGGAGAGGGGAGGGAAGGGG + Intergenic
1044666824 8:94640800-94640822 GAATGGAGAGGCGAGGGCAGGGG - Intergenic
1048484271 8:134832418-134832440 GAAATGGGAAGCGAGGGGCGGGG - Intergenic
1050284960 9:4091662-4091684 GAAGTGAGAGTCGAGCGAAGGGG - Intronic
1053786206 9:41654558-41654580 GAAATGAGAGGAGAGGCAAGTGG + Intergenic
1054158845 9:61659640-61659662 GAAATGAGAGGAGAGGCAAGTGG - Intergenic
1054174921 9:61868503-61868525 GAAATGAGAGGAGAGGCAAGTGG + Intergenic
1054478619 9:65590645-65590667 GAAATGAGAGGAGAGGCAAGTGG - Intergenic
1054662618 9:67712290-67712312 GAAATGAGAGGAGAGGCAAGTGG - Intergenic
1057706714 9:97399928-97399950 GCCTTGAGAGGCCAGGGCCGGGG - Intergenic
1058022494 9:100103670-100103692 GAAAGGAGAGGCGAGGGGAGGGG + Intronic
1058619110 9:106864190-106864212 GAACAGAGAGGCGAGGAGCGGGG + Intronic
1060900251 9:127250709-127250731 GAATTGAAGGGAGAGGGATGTGG + Intronic
1061399078 9:130358556-130358578 GAAGTGTGTGGCGAGGGAGGGGG + Intronic
1061656796 9:132098077-132098099 GATCAGAGAGGCGAGGGAGGCGG + Intergenic
1061661401 9:132132563-132132585 CAATGGAGGGGTGAGGGACGGGG + Intergenic
1062050108 9:134442805-134442827 GAACTGAGAGGCAAGGGAGGGGG + Intergenic
1192546389 X:72018323-72018345 GAACGGTGAGGCGAGGGCCGGGG - Intergenic
1194578022 X:95638121-95638143 GAATTGGTGGGGGAGGGACGTGG - Intergenic
1197299323 X:124758869-124758891 GAGTTGAGAGGAGGGGGAAGAGG + Intronic