ID: 1006053960

View in Genome Browser
Species Human (GRCh38)
Location 6:31366994-31367016
Sequence AGGTGGAGAGAGGGATGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006053960_1006053968 8 Left 1006053960 6:31366994-31367016 CCATGACATCCCTCTCTCCACCT No data
Right 1006053968 6:31367025-31367047 GTCCTGGGCATCCACCTCCAGGG No data
1006053960_1006053964 -7 Left 1006053960 6:31366994-31367016 CCATGACATCCCTCTCTCCACCT No data
Right 1006053964 6:31367010-31367032 TCCACCTCAAAGCTCGTCCTGGG No data
1006053960_1006053967 7 Left 1006053960 6:31366994-31367016 CCATGACATCCCTCTCTCCACCT No data
Right 1006053967 6:31367024-31367046 CGTCCTGGGCATCCACCTCCAGG No data
1006053960_1006053963 -8 Left 1006053960 6:31366994-31367016 CCATGACATCCCTCTCTCCACCT No data
Right 1006053963 6:31367009-31367031 CTCCACCTCAAAGCTCGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006053960 Original CRISPR AGGTGGAGAGAGGGATGTCA TGG (reversed) Intergenic