ID: 1006053961

View in Genome Browser
Species Human (GRCh38)
Location 6:31367003-31367025
Sequence CGAGCTTTGAGGTGGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006053961_1006053967 -2 Left 1006053961 6:31367003-31367025 CCCTCTCTCCACCTCAAAGCTCG No data
Right 1006053967 6:31367024-31367046 CGTCCTGGGCATCCACCTCCAGG No data
1006053961_1006053973 28 Left 1006053961 6:31367003-31367025 CCCTCTCTCCACCTCAAAGCTCG No data
Right 1006053973 6:31367054-31367076 AGCAGCGCAGCAGCGCCACCTGG No data
1006053961_1006053968 -1 Left 1006053961 6:31367003-31367025 CCCTCTCTCCACCTCAAAGCTCG No data
Right 1006053968 6:31367025-31367047 GTCCTGGGCATCCACCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006053961 Original CRISPR CGAGCTTTGAGGTGGAGAGA GGG (reversed) Intergenic
No off target data available for this crispr