ID: 1006053961 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:31367003-31367025 |
Sequence | CGAGCTTTGAGGTGGAGAGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1006053961_1006053967 | -2 | Left | 1006053961 | 6:31367003-31367025 | CCCTCTCTCCACCTCAAAGCTCG | No data | ||
Right | 1006053967 | 6:31367024-31367046 | CGTCCTGGGCATCCACCTCCAGG | No data | ||||
1006053961_1006053968 | -1 | Left | 1006053961 | 6:31367003-31367025 | CCCTCTCTCCACCTCAAAGCTCG | No data | ||
Right | 1006053968 | 6:31367025-31367047 | GTCCTGGGCATCCACCTCCAGGG | No data | ||||
1006053961_1006053973 | 28 | Left | 1006053961 | 6:31367003-31367025 | CCCTCTCTCCACCTCAAAGCTCG | No data | ||
Right | 1006053973 | 6:31367054-31367076 | AGCAGCGCAGCAGCGCCACCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1006053961 | Original CRISPR | CGAGCTTTGAGGTGGAGAGA GGG (reversed) | Intergenic | ||