ID: 1006053962

View in Genome Browser
Species Human (GRCh38)
Location 6:31367004-31367026
Sequence ACGAGCTTTGAGGTGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006053962_1006053973 27 Left 1006053962 6:31367004-31367026 CCTCTCTCCACCTCAAAGCTCGT No data
Right 1006053973 6:31367054-31367076 AGCAGCGCAGCAGCGCCACCTGG No data
1006053962_1006053967 -3 Left 1006053962 6:31367004-31367026 CCTCTCTCCACCTCAAAGCTCGT No data
Right 1006053967 6:31367024-31367046 CGTCCTGGGCATCCACCTCCAGG No data
1006053962_1006053974 30 Left 1006053962 6:31367004-31367026 CCTCTCTCCACCTCAAAGCTCGT No data
Right 1006053974 6:31367057-31367079 AGCGCAGCAGCGCCACCTGGTGG No data
1006053962_1006053968 -2 Left 1006053962 6:31367004-31367026 CCTCTCTCCACCTCAAAGCTCGT No data
Right 1006053968 6:31367025-31367047 GTCCTGGGCATCCACCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006053962 Original CRISPR ACGAGCTTTGAGGTGGAGAG AGG (reversed) Intergenic