ID: 1006053966 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:31367014-31367036 |
Sequence | GATGCCCAGGACGAGCTTTG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1006053966_1006053973 | 17 | Left | 1006053966 | 6:31367014-31367036 | CCTCAAAGCTCGTCCTGGGCATC | No data | ||
Right | 1006053973 | 6:31367054-31367076 | AGCAGCGCAGCAGCGCCACCTGG | No data | ||||
1006053966_1006053974 | 20 | Left | 1006053966 | 6:31367014-31367036 | CCTCAAAGCTCGTCCTGGGCATC | No data | ||
Right | 1006053974 | 6:31367057-31367079 | AGCGCAGCAGCGCCACCTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1006053966 | Original CRISPR | GATGCCCAGGACGAGCTTTG AGG (reversed) | Intergenic | ||