ID: 1006053967

View in Genome Browser
Species Human (GRCh38)
Location 6:31367024-31367046
Sequence CGTCCTGGGCATCCACCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006053962_1006053967 -3 Left 1006053962 6:31367004-31367026 CCTCTCTCCACCTCAAAGCTCGT No data
Right 1006053967 6:31367024-31367046 CGTCCTGGGCATCCACCTCCAGG No data
1006053961_1006053967 -2 Left 1006053961 6:31367003-31367025 CCCTCTCTCCACCTCAAAGCTCG No data
Right 1006053967 6:31367024-31367046 CGTCCTGGGCATCCACCTCCAGG No data
1006053960_1006053967 7 Left 1006053960 6:31366994-31367016 CCATGACATCCCTCTCTCCACCT No data
Right 1006053967 6:31367024-31367046 CGTCCTGGGCATCCACCTCCAGG No data
1006053965_1006053967 -10 Left 1006053965 6:31367011-31367033 CCACCTCAAAGCTCGTCCTGGGC No data
Right 1006053967 6:31367024-31367046 CGTCCTGGGCATCCACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006053967 Original CRISPR CGTCCTGGGCATCCACCTCC AGG Intergenic
No off target data available for this crispr