ID: 1006054063

View in Genome Browser
Species Human (GRCh38)
Location 6:31367524-31367546
Sequence CTGGGTGCTCAGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054055_1006054063 8 Left 1006054055 6:31367493-31367515 CCTTCTGGGGGTCCTGGGGCTGC No data
Right 1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG No data
1006054057_1006054063 -4 Left 1006054057 6:31367505-31367527 CCTGGGGCTGCTGGTTGTCCTGG No data
Right 1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG No data
1006054045_1006054063 26 Left 1006054045 6:31367475-31367497 CCTAGAAGTGAGGTCACCCCTTC No data
Right 1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG No data
1006054054_1006054063 9 Left 1006054054 6:31367492-31367514 CCCTTCTGGGGGTCCTGGGGCTG No data
Right 1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG No data
1006054053_1006054063 10 Left 1006054053 6:31367491-31367513 CCCCTTCTGGGGGTCCTGGGGCT No data
Right 1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054063 Original CRISPR CTGGGTGCTCAGAGGGAAGA TGG Intergenic
No off target data available for this crispr