ID: 1006054943

View in Genome Browser
Species Human (GRCh38)
Location 6:31377405-31377427
Sequence GGTACAGGCCAGGGTGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054943_1006054947 -7 Left 1006054943 6:31377405-31377427 CCACAGACACCCTGGCCTGTACC 0: 1
1: 0
2: 1
3: 34
4: 243
Right 1006054947 6:31377421-31377443 CTGTACCCTAGTGCTTTGTATGG 0: 1
1: 0
2: 1
3: 8
4: 117
1006054943_1006054950 -1 Left 1006054943 6:31377405-31377427 CCACAGACACCCTGGCCTGTACC 0: 1
1: 0
2: 1
3: 34
4: 243
Right 1006054950 6:31377427-31377449 CCTAGTGCTTTGTATGGCTGTGG 0: 1
1: 0
2: 15
3: 289
4: 2918
1006054943_1006054951 29 Left 1006054943 6:31377405-31377427 CCACAGACACCCTGGCCTGTACC 0: 1
1: 0
2: 1
3: 34
4: 243
Right 1006054951 6:31377457-31377479 GCCCCTACTTCTGATCCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054943 Original CRISPR GGTACAGGCCAGGGTGTCTG TGG (reversed) Intergenic