ID: 1006054944

View in Genome Browser
Species Human (GRCh38)
Location 6:31377414-31377436
Sequence AAGCACTAGGGTACAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054944_1006054956 26 Left 1006054944 6:31377414-31377436 CCCTGGCCTGTACCCTAGTGCTT 0: 1
1: 0
2: 0
3: 5
4: 131
Right 1006054956 6:31377463-31377485 ACTTCTGATCCCCTAGGACTGGG 0: 1
1: 0
2: 0
3: 7
4: 140
1006054944_1006054955 25 Left 1006054944 6:31377414-31377436 CCCTGGCCTGTACCCTAGTGCTT 0: 1
1: 0
2: 0
3: 5
4: 131
Right 1006054955 6:31377462-31377484 TACTTCTGATCCCCTAGGACTGG 0: 1
1: 0
2: 0
3: 4
4: 94
1006054944_1006054951 20 Left 1006054944 6:31377414-31377436 CCCTGGCCTGTACCCTAGTGCTT 0: 1
1: 0
2: 0
3: 5
4: 131
Right 1006054951 6:31377457-31377479 GCCCCTACTTCTGATCCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 123
1006054944_1006054950 -10 Left 1006054944 6:31377414-31377436 CCCTGGCCTGTACCCTAGTGCTT 0: 1
1: 0
2: 0
3: 5
4: 131
Right 1006054950 6:31377427-31377449 CCTAGTGCTTTGTATGGCTGTGG 0: 1
1: 0
2: 15
3: 289
4: 2918

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054944 Original CRISPR AAGCACTAGGGTACAGGCCA GGG (reversed) Intergenic