ID: 1006054945

View in Genome Browser
Species Human (GRCh38)
Location 6:31377415-31377437
Sequence AAAGCACTAGGGTACAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054945_1006054956 25 Left 1006054945 6:31377415-31377437 CCTGGCCTGTACCCTAGTGCTTT 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1006054956 6:31377463-31377485 ACTTCTGATCCCCTAGGACTGGG 0: 1
1: 0
2: 0
3: 7
4: 140
1006054945_1006054951 19 Left 1006054945 6:31377415-31377437 CCTGGCCTGTACCCTAGTGCTTT 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1006054951 6:31377457-31377479 GCCCCTACTTCTGATCCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 123
1006054945_1006054955 24 Left 1006054945 6:31377415-31377437 CCTGGCCTGTACCCTAGTGCTTT 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1006054955 6:31377462-31377484 TACTTCTGATCCCCTAGGACTGG 0: 1
1: 0
2: 0
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054945 Original CRISPR AAAGCACTAGGGTACAGGCC AGG (reversed) Intergenic