ID: 1006054948

View in Genome Browser
Species Human (GRCh38)
Location 6:31377426-31377448
Sequence CACAGCCATACAAAGCACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054948_1006054955 13 Left 1006054948 6:31377426-31377448 CCCTAGTGCTTTGTATGGCTGTG 0: 1
1: 0
2: 3
3: 11
4: 164
Right 1006054955 6:31377462-31377484 TACTTCTGATCCCCTAGGACTGG 0: 1
1: 0
2: 0
3: 4
4: 94
1006054948_1006054961 29 Left 1006054948 6:31377426-31377448 CCCTAGTGCTTTGTATGGCTGTG 0: 1
1: 0
2: 3
3: 11
4: 164
Right 1006054961 6:31377478-31377500 GGACTGGGAGCAGCCCGCCTGGG 0: 1
1: 0
2: 0
3: 20
4: 213
1006054948_1006054951 8 Left 1006054948 6:31377426-31377448 CCCTAGTGCTTTGTATGGCTGTG 0: 1
1: 0
2: 3
3: 11
4: 164
Right 1006054951 6:31377457-31377479 GCCCCTACTTCTGATCCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 123
1006054948_1006054956 14 Left 1006054948 6:31377426-31377448 CCCTAGTGCTTTGTATGGCTGTG 0: 1
1: 0
2: 3
3: 11
4: 164
Right 1006054956 6:31377463-31377485 ACTTCTGATCCCCTAGGACTGGG 0: 1
1: 0
2: 0
3: 7
4: 140
1006054948_1006054962 30 Left 1006054948 6:31377426-31377448 CCCTAGTGCTTTGTATGGCTGTG 0: 1
1: 0
2: 3
3: 11
4: 164
Right 1006054962 6:31377479-31377501 GACTGGGAGCAGCCCGCCTGGGG 0: 1
1: 0
2: 2
3: 19
4: 197
1006054948_1006054960 28 Left 1006054948 6:31377426-31377448 CCCTAGTGCTTTGTATGGCTGTG 0: 1
1: 0
2: 3
3: 11
4: 164
Right 1006054960 6:31377477-31377499 AGGACTGGGAGCAGCCCGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054948 Original CRISPR CACAGCCATACAAAGCACTA GGG (reversed) Intergenic