ID: 1006054951

View in Genome Browser
Species Human (GRCh38)
Location 6:31377457-31377479
Sequence GCCCCTACTTCTGATCCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054949_1006054951 7 Left 1006054949 6:31377427-31377449 CCTAGTGCTTTGTATGGCTGTGG 0: 1
1: 1
2: 6
3: 149
4: 1971
Right 1006054951 6:31377457-31377479 GCCCCTACTTCTGATCCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 123
1006054943_1006054951 29 Left 1006054943 6:31377405-31377427 CCACAGACACCCTGGCCTGTACC 0: 1
1: 0
2: 1
3: 34
4: 243
Right 1006054951 6:31377457-31377479 GCCCCTACTTCTGATCCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 123
1006054948_1006054951 8 Left 1006054948 6:31377426-31377448 CCCTAGTGCTTTGTATGGCTGTG 0: 1
1: 0
2: 3
3: 11
4: 164
Right 1006054951 6:31377457-31377479 GCCCCTACTTCTGATCCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 123
1006054944_1006054951 20 Left 1006054944 6:31377414-31377436 CCCTGGCCTGTACCCTAGTGCTT 0: 1
1: 0
2: 0
3: 5
4: 131
Right 1006054951 6:31377457-31377479 GCCCCTACTTCTGATCCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 123
1006054946_1006054951 14 Left 1006054946 6:31377420-31377442 CCTGTACCCTAGTGCTTTGTATG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1006054951 6:31377457-31377479 GCCCCTACTTCTGATCCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 123
1006054945_1006054951 19 Left 1006054945 6:31377415-31377437 CCTGGCCTGTACCCTAGTGCTTT 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1006054951 6:31377457-31377479 GCCCCTACTTCTGATCCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054951 Original CRISPR GCCCCTACTTCTGATCCCCT AGG Intergenic