ID: 1006054953

View in Genome Browser
Species Human (GRCh38)
Location 6:31377459-31377481
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 111}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054953_1006054965 9 Left 1006054953 6:31377459-31377481 CCCTACTTCTGATCCCCTAGGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1006054965 6:31377491-31377513 CCCGCCTGGGGGAGACCATCAGG 0: 1
1: 0
2: 0
3: 12
4: 107
1006054953_1006054969 23 Left 1006054953 6:31377459-31377481 CCCTACTTCTGATCCCCTAGGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1006054969 6:31377505-31377527 ACCATCAGGATGTCTATGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 206
1006054953_1006054960 -5 Left 1006054953 6:31377459-31377481 CCCTACTTCTGATCCCCTAGGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1006054960 6:31377477-31377499 AGGACTGGGAGCAGCCCGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 227
1006054953_1006054968 19 Left 1006054953 6:31377459-31377481 CCCTACTTCTGATCCCCTAGGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1006054968 6:31377501-31377523 GGAGACCATCAGGATGTCTATGG 0: 1
1: 0
2: 1
3: 27
4: 190
1006054953_1006054962 -3 Left 1006054953 6:31377459-31377481 CCCTACTTCTGATCCCCTAGGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1006054962 6:31377479-31377501 GACTGGGAGCAGCCCGCCTGGGG 0: 1
1: 0
2: 2
3: 19
4: 197
1006054953_1006054963 -2 Left 1006054953 6:31377459-31377481 CCCTACTTCTGATCCCCTAGGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1006054963 6:31377480-31377502 ACTGGGAGCAGCCCGCCTGGGGG 0: 1
1: 0
2: 1
3: 12
4: 228
1006054953_1006054961 -4 Left 1006054953 6:31377459-31377481 CCCTACTTCTGATCCCCTAGGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1006054961 6:31377478-31377500 GGACTGGGAGCAGCCCGCCTGGG 0: 1
1: 0
2: 0
3: 20
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054953 Original CRISPR GTCCTAGGGGATCAGAAGTA GGG (reversed) Intergenic