ID: 1006054955

View in Genome Browser
Species Human (GRCh38)
Location 6:31377462-31377484
Sequence TACTTCTGATCCCCTAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054948_1006054955 13 Left 1006054948 6:31377426-31377448 CCCTAGTGCTTTGTATGGCTGTG 0: 1
1: 0
2: 3
3: 11
4: 164
Right 1006054955 6:31377462-31377484 TACTTCTGATCCCCTAGGACTGG 0: 1
1: 0
2: 0
3: 4
4: 94
1006054945_1006054955 24 Left 1006054945 6:31377415-31377437 CCTGGCCTGTACCCTAGTGCTTT 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1006054955 6:31377462-31377484 TACTTCTGATCCCCTAGGACTGG 0: 1
1: 0
2: 0
3: 4
4: 94
1006054946_1006054955 19 Left 1006054946 6:31377420-31377442 CCTGTACCCTAGTGCTTTGTATG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1006054955 6:31377462-31377484 TACTTCTGATCCCCTAGGACTGG 0: 1
1: 0
2: 0
3: 4
4: 94
1006054944_1006054955 25 Left 1006054944 6:31377414-31377436 CCCTGGCCTGTACCCTAGTGCTT 0: 1
1: 0
2: 0
3: 5
4: 131
Right 1006054955 6:31377462-31377484 TACTTCTGATCCCCTAGGACTGG 0: 1
1: 0
2: 0
3: 4
4: 94
1006054949_1006054955 12 Left 1006054949 6:31377427-31377449 CCTAGTGCTTTGTATGGCTGTGG 0: 1
1: 1
2: 6
3: 149
4: 1971
Right 1006054955 6:31377462-31377484 TACTTCTGATCCCCTAGGACTGG 0: 1
1: 0
2: 0
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054955 Original CRISPR TACTTCTGATCCCCTAGGAC TGG Intergenic